Labshake search
Citations for Roche :
2251 - 2300 of 9230 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 10µg/mL DNase I (Roche), 5mM MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase A (1mg/ml, Roche) in 1XPBS-for 3 hours at room temperature (RT ...
-
bioRxiv - Immunology 2023Quote: ... DNAse I 10U/mL (Roche), 5% iFCS and 10 mM HEPES ...
-
bioRxiv - Immunology 2023Quote: ... DNAse I 10U/mL (Roche), 5% iFCS and 10 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (0.3 μg/ml, Roche) was used for nuclear staining ...
-
bioRxiv - Bioengineering 2023Quote: ... 150 μg/mL transferrin (Roche), and with Matrigel (Cat#354277 ...
-
bioRxiv - Cell Biology 2023Quote: ... transferrin (150 mg/ml, ROCHE), ascorbic acid (50 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... transferrin (150 mg/ml, ROCHE), ascorbic acid (50 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... transferrin (150 mg/mL, ROCHE), ascorbic acid (50 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 300 mg/ml transferrin (Roche), 50 g/ml ascorbic acid ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.04 mg/mL catalase (Roche), 5% w/v glucose ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... 0.025 μg/ml Liberase (Roche), 0.6μg/ml DNase I (ThermoFisher) ...
-
bioRxiv - Biophysics 2024Quote: ... 2170 U/ml catalase (Roche) and 3 mM Trolox (Sigma)) ...
-
bioRxiv - Biophysics 2024Quote: ... 2170 U/ml catalase (Roche) and 3 mM Trolox (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... 0.2mg/ml Collagenase P (Roche) and 0.1mg/ml DNase (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.2LJmg/mL DNase I (Roche) and 4% Trypsin (0.25% in Tris Saline ...
-
bioRxiv - Neuroscience 2024Quote: ... and DispaseII (Roche, 1mg/ml) and minced before placing on thermocycler at 37C for 1h at 1000rpm ...
-
bioRxiv - Genomics 2024Quote: ... protease inhibitor cocktail ml(Roche); and SUPERaseIn RNase Inhibitor (Ambion)] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1mg/ml collagenase D (Roche) and 25µg/ml DNase 1 (THermo Fisher Scientific)) ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... 10 µg/ml insulin (Roche), 0.5 µg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... laminin (5 µg/ml, Roche), bovine collagen I (30µg/ml ...
-
bioRxiv - Immunology 2024Quote: ... 12,5 μg/ml DNAse (Roche), and 1% FBS (Bodego ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg/ml Bevacizumab (Roche) was administered ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 μg/ml Insulin (Roche), 25 ng/ml bFGF (Corning ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2mg/mL collagenase (Roche). Following digestion and three subsequent PBS washes ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.525mg/ml collagenase D (Roche), 5 unit/ml Dispase (Stemcell Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... 20mg/mL dispase II (Roche), 0.3μM calcium ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... Beads with cells were washed twice in 1 ml Digitonin Buffer (20 mM HEPES-KOH pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1x Roche cOmplete™; 0.05% digitonin), and resuspended in 50 µl Digitonin Buffer with addition of 2.5 µl CUTANA pAG-MNase (20x stock) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Tissues were homogenized in 1 ml N-PER (brain) or T-PER (other organs) + Complete Mini protease inhibitor cocktail tablet (Roche, Mannheim, Germany) in FastPrep Lysing Matrix D tubes on a FastPrep homogenizer ...
-
bioRxiv - Immunology 2019Quote: ... samples were boiled for 10 min in 1 mL of TE buffer and were loaded on a nylon membrane (Roche, Basel, Switzerland) using a Minislot 30 apparatus (Immunetics ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse hind limb muscles (tibialis anterior, quadriceps and gastrocnemius) were minced and incubated in a 1 mg/ml collagenase/dispase solution (Roche, Basel, Switzerland) with agitation at 37°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... and mixed with 1 mL Ni Sepharose 6Fast Flow (Cytiva, Tokyo Japan) (MinD) or cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland) (MinE and msfGFP-MinC) ...
-
bioRxiv - Cancer Biology 2022Quote: Primary mouse MEC organoids were prepared by manual chopping of mouse mammary gland tissues harvested from 10–12-week-old mice followed by digestion with shaking for 1 hr at 37 °C with Collagenase A from Clostridium histolyticum (10 mg/mL; Roche, Cat. #: 13560925) and Hyaluronidase from bovine testes (1 mg/mL ...
-
bioRxiv - Plant Biology 2021Quote: ... The final clean nuclear pellet was resuspended in 1 mL nuclear lysis buffer (20 mM Tris pH 8, 2 mM EDTA, 0.1% SDS, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and sonicated on the Covaris E220 (150W peak power ...