Labshake search
Citations for Roche :
2001 - 2050 of 7604 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... transferred on nylon membrane and hybridized with DIG-labelled probes obtained by PCR DIG Probe Synthesis Kit (Roche) with specific primers (see table primers list) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing, Indianapolis, IN) for 35 cycles using an annealing temperature of 64°C ...
-
bioRxiv - Genomics 2020Quote: ... Detection was conducted with DISCOVERY UltraMap anti-Goat multimer RUO (Roche Ventana) for 12 minutes at 37°C ...
-
bioRxiv - Plant Biology 2019Quote: ... in the LightCycler 480 II detection system (Roche Molecular Systems, Pleasanton, CA) in a volume of 10 μl ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were briefly equilibrated with 10 mL 1x Detection Buffer (Roche, 115857262001). To detect DIG-labeled probing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were detected using an anti-rabbit HQ detection system (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... The chemi-luminescence detection was performed with DIG Substrate (Roche, Basel, Switzerland).
-
bioRxiv - Developmental Biology 2022Quote: ... Detection was performed with anti-DIG-alkaline phosphatase (AP) Fab fragments (Roche) diluted 1:2000 in blocking solution ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was performed in a LightCycler 1.5 detection system (Roche, Meylan France) using the LightCycler FastStart DNA Master plus SYBR Green I kit (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Labelling and detection used random prime labelling incorporating fluorescein tagged dUTP (Roche). Following probing ...
-
bioRxiv - Physiology 2022Quote: ... Colorimetric detection was performed by incubating with NBT/BCIP solution (Roche, # 11697471001) for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed in a LightCycler 1.5 detection system (Roche, Meylan France) using the LightCycler FastStart DNA Master plus SYBR Green I kit (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... and immunological detection was carried out with anti-DIG peroxidase antibody (Roche) at 4°C overnight and were visualized using Cy3-conjugated Tyramide Signal Amplification system (Perkin-Elmer ...
-
bioRxiv - Microbiology 2022Quote: ... Amplification and detection were performed with the Light Cycler 480 II (Roche) using the following program ...
-
bioRxiv - Neuroscience 2022Quote: ... Chromogenic detection was then performed using NBT-BCIP stock solution (Roche, 11681451001) diluted 1:50 in staining buffer until sufficient signal was observed ...
-
bioRxiv - Neuroscience 2023Quote: ... The FITC-UDP detection was using peroxidase conjugated anti-FITC antibody (Roche) and FITC-tyramide signal amplification system (Akoya bioscience).
-
bioRxiv - Cell Biology 2023Quote: ... Probe detection was performed with alkaline phosphatase conjugated anti-DIG antibodies (Roche) and nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP ...
-
bioRxiv - Microbiology 2024Quote: ... The membranes were exposed to chemiluminescence detection films (Roche Diagnistics, Rotkreuz, Switzerland). Detection of anti-actin served as loading control for the lysate.
-
bioRxiv - Microbiology 2024Quote: ... The membranes were exposed to chemiluminescence detection films (Roche Diagnistics, Rotkreuz, Switzerland). Detection of actin served as loading control for the lysate.
-
bioRxiv - Cell Biology 2021Quote: ... for 1 h at RT and 20 μg/mL Laminin (Roche, Switzerland) for 4 h at 37 °C ...
-
bioRxiv - Genetics 2022Quote: ... The RT-qPCR was done in duplicate on a Lightcycler 480 (Roche) with SYBR green for detection (2,5 μl of mastermix ...
-
bioRxiv - Physiology 2021Quote: ... RT-qPCR was performed in duplicate with the LightCycler 480 (Roche Diagnostics) instrument using LightCycler 384-well plates with sealing foil (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RT-qPCR cycling analysis was performed by LC-480 device (Roche). qBasePlus software 3.2 (http://www.biogazelle.com ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed with the Light Cycler 96 (Roche, Geneva, Switzerland) using iQ SYBR Green Supermix (170-8882AP ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR was performed using SYBR Fast qPCR Master Mix (Kapa Biosystems) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Dengue virus was quantified via RT-qPCR using the LightCycler 480 (Roche). We used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 7.4 at room temperature (RT)) supplemented with protease inhibitor cocktail (Roche) and Benzonase (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... The RT-QPCRs were performed using a LightCycler480 machine (Roche; Mannheim, Germany) and data were extracted using LightCycler480 software ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR reactions were performed on a LightCycler 96 (Roche, Mannheim, Germany) using qPCRBIO SyGreen Mix (PCR Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR is performed using The LightCycler 480 SYBR Green I (Roche), and the reaction was run at LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We analysed RT-qPCR reaction using the LightCycler® 96 Software (Roche). We calculated viral genome concentration (Vg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates (see RT-qPCR section for thermocycling details) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was run on a LightCycler 480 II (Roche Applied Science) using 384 well plates ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We measured RT-qPCR reaction on a LightCycler® 96 Instrument (Roche) using the SYBR-green channel and with cycling conditions as follows ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR was performed in duplicate with the LightCycler 480 (Roche Diagnostics) instrument using LightCycler 384-well plates with sealing foil (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... Prothrombin time was measured using the Coagucheck (Roche) meter ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Microbiology 2021Quote: ... The 16S rRNA V3–V4 amplicon was amplified using a KAPA HiFi HotStart ReadyMix PCR Kit (KAPA BioSystems, USA). the amplicon PCR forward primer (5’-CCTACGGGNGGCWGCAG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were purified according to the instructions of the manufacturer using the High Pure PCR Template Preparation Kit (Roche) followed by RNAse A digest and a final purification with the High Pure PCR Product Purification Kit (Roche).
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B phosphotranferase (HYG) or blastacidin S deamidase gene (BSD) generated using the PCR DIG Probe Synthesis Kit (Roche). The blot was developed according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR analyses confirmed mouse genotypes with DNA isolated from ear biopsies using the KAPA Mouse Genotyping Kits (Kapa Biosystems). All PCR primers are listed in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... The library was enriched using 14 PCR cycles and quantified with Kapa NGS library quantification kit (Kapa Biosystems, KK4824) before pooling at a concentration of 20nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-capture amplification was performed using the KAPA HiFi Hot Start PCR ReadyMix Kit (KAPA Biosystems, Catalogue no. KK2601). Post-capture amplified libraries were quality controlled and quantified using a Tapestation 2200 with the High Sensitivity reagents.
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2019Quote: Digoxigenin (DIG)-labelled probes for in situ hybridization was synthesized by PCR using DIG RNA labelling kit (Roche #11175025910). The probes for Ssadh and CG33791 (αKDH ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reaction was prepared using a LightCycler® 480 SYBR Green I Master kit (Roche Diagnostics, Mannheim, Germany) and the PCR was performed with a LightCycler® 480 Instrument II (384-well ...
-
bioRxiv - Cell Biology 2019Quote: ... The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Sequencing libraries were sequenced using Novaseq 6000 (Illumina ...