Labshake search
Citations for Roche :
1801 - 1850 of 6394 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were conducted in a 10-µL final volume with 5 µL of 2X FastStar Universal SyBR green Master (Roche, Switzerland), 1.5 µL of forward/reverse primer mix (Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... After that pelleted beads were gently resuspended in washing buffer containing 4xTBS, 5% NP-40, phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and washed 10 times with gentle agitation ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Neuroscience 2019Quote: ... The tissue was homogenized in homogenization buffer (20 mM HEPES, pH 7.4; 320 mM sucrose, 5 mM EDTA) supplemented with protease inhibitors (Roche, Cat #11697498001) using a glass Dounce homogenizer ...
-
bioRxiv - Plant Biology 2019Quote: ... Total proteins from 120 seedlings were extracted with 150 µL of extraction buffer (50 mM Tris-HCl pH 7.4, 80 mM NaCl, 0.1 % Tween 20, 10 % glycerol, 10 mM dithiothreitol, 2× Protease inhibitor cocktail [11873580001, Roche], 5 mM PMSF). Prior to protein quantification ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Biochemistry 2020Quote: ... before lysis in swelling buffer (5 mM PIPES pH8.0, 85mM KCl) freshly supplemented with 1x protease inhibitor cocktail (Roche, cat. 04693116001) and 0.5% NP-40 ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed twice in PBS and resuspended in 100 μL annexin V incubation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing 1% annexin V FLOUS (Roche Molecular Biochemicals) and 500 μg/μl PI stain ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tissue was then washed with PBST extensively (10 times or more for 5 minutes) before development with BM-purple (1ml peer well, Roche Diagnostics). Time of development was approximately 24 hours at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 148.5 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1x PhosSTOP Roche, 5x cOmplete protease inhibitor cocktail Roche, 1 mM DTT) using a cell scraper (TPP 99003) ...
-
bioRxiv - Microbiology 2022Quote: ... The capsids were suspended in sample buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, PIs [Roche cOmplete]), and adsorbed to nitrocellulose membranes (BioTrace™ ...
-
bioRxiv - Microbiology 2022Quote: The samples were lysed in Laemmli buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, bromophenol blue, PIs [Roche cOmplete]). The proteins were separated on linear 7.5 to 12% or 10 to 15% SDS-PAGE ...
-
bioRxiv - Microbiology 2022Quote: ... 50 µl of the post-nuclear supernatant was saved as the input lysate and 450 µl was incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were pelleted by centrifugation at 2500g for 5 minutes and resuspended in 880ul Nuclear Lysis Buffer (50mM Tris HCl, 10mM EDTA, 1% SDS, 1X protease inhibitors (Roche, 04693124001)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Neuroscience 2020Quote: ... nt 1280-1350 from sequence NM_008553 detected with the mASCL1 probe (Universal Probe Library probe #74, Roche, Cat.No. 04688970001; 5′-(Fam)-GGCAGCAG-(Dark Quencher)-3′) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Telomeric repeats were probed by incubating the membrane with telomeric probe containing digoxigenin (5’CCCTAACCCTAACCCTAACCCTAA-DIG; Integrated DNA Technologies, Coralville, IA; Table S1) overnight at 42°C DIG Easy Hyb™ buffer (Roche). Blots were washed in 2X saline-sodium citrate (SSC ...
-
bioRxiv - Molecular Biology 2019Quote: Re-amplification of primary WTA products was performed in a reaction volume of 50 μl comprising 5 μl Expand Long Template Buffer 1 (Expand Long Template PCR System, Roche Diagnostics), 6 μl of CP2-15C or CP2-9C primer (2.88 μM ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed with buffer MB#1 (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.2% NP-40, 1x Roche complete EDTA-free). Chromatin was fragmented with MNase for 10 min at 37°C and digestion was stopped with 5 mM EGTA at 65°C for 10 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of cDNA were used as a template in a 5- l reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Bacteria were pelleted and resuspended in lysis buffer (30 mM Tris pH 7.5, 450 mM NaCl, 5 mM β-mercaptoethanol, complete™ EDTA-free Protease Inhibitor Cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Biochemistry 2019Quote: ... microtubules were treated with 200 μg/mL subtilisin for 45 min at 303 K as described previously.28 Proteolysis was stopped with the addition of 5 mM PMSF (Roche Diagnostics). Subtilisin-treated microtubules were spun at 100,000xg for 30 min at 298 K and were resuspended in reaction buffer at 5 mM MgCl2 ...
-
bioRxiv - Genomics 2019Quote: ... after cells were lysed with Farnham Lysis Buffer (5 mM HEPES pH 8.0, 85 mM KCl, 0.5% IGEPAL, Roche Protease Inhibitor Cocktail), and nuclei were resuspended in RIPA buffer (1x PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... cells were incubated for 48 h at 37°C in 5% CO2, harvested and lysed using M-PER Mammalian Protein Extraction Reagent (Thermo Scientific, 78501) (with 1X Roche Complete Protease Inhibitor and 100 mM NaCl) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Quantitative Real-time PCR reactions were prepared manually in a total volume of 10 µl by mixing 5 µl 2x KAPA SYBR FAST ABI Prism master mix (KAPA Biosystems), 0.2 µl forward and reverse primer mix (10 µM each primer) ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). Human cells from differentiation experiments were also lysed in 300 µl Tri-Reagent for 5 minutes at RT mechanically dissociated/lysed using a sterile scraper ...
-
bioRxiv - Physiology 2020Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 minutes at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Plant Biology 2022Quote: ... RT was performed with 5 µg of total mRNA using Transcriptor Reverse Transcriptase and oligo (dT)15 primer (Roche, Mannheim, Germany). QRT-PCR was run on a LightCycler 480 (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Developmental Biology 2022Quote: ... The tissue was then washed with PBT extensively (10 times or more for 5 minutes) before development with BM-purple (1ml per well, Roche Diagnostics). Time of development was approximately 20 minutes at room temperature to 24 hours at 4°C depending on the probe ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 min at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl from the partially amplified barcoded fragments was subjected to SYBR Green qPCR in a LightCycler 480 System (Roche, Germany) using the FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Microbiology 2023Quote: ... Cross-linked cells were lysed by sonication in lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche). Cell lysates were treated with 2 units of Turbo DNase (Life Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... indexes and sequencing sequences) was performed on 5 µl of purified first step PCR products using Expand™ Long Template PCR System (Roche) with the following thermocycling program ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA, 10 mM β-mercaptoethanol, 10 mM Hepes pH 7.5, supplemented with 1× Complete protease inhibitor cocktail, Roche, Germany), passed through 27 G syringe and left 20 min in ice ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 mM KCl, 5 mM MgCl2, 0.05% NP-40, EDTA-free cOmplete mini protease inhibitor [Roche, 11836153001], PhosSTOP [Roche, PHOSS-RO]). If indicated ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...