Labshake search
Citations for Roche :
1951 - 2000 of 6394 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... where N5 represents 5 random bases used to improve sequencing quality) using 25 µL of Kapa Hifi mastermix (Kapa Biosystems, Woburn, MA, USA), 2.5 µl of each primer (10 µM) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 5 mM EDTA, 50 mM NaF, 1 mM PMSF supplemented with Roche 1X Halt Protease inhibitor cocktail), incubated for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested and lysed using immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Approximately 1.5 mg of lysate from each sample was incubated with brachyury antibody at 4°C for 4 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pooled together and resuspended in 1.5 mL immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Cells were then incubated for 30 minutes on ice prior to centrifugation at high speed (15,000 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS, 1 mM EDTA, 1 mM DTT, 1 mM Na3VO4×2H2O, 5 µM pepstatin A, 10 µM leupeptin, 2X Roche protease inhibitor cocktail), 200µl glass beads were added ...
-
bioRxiv - Plant Biology 2022Quote: ... protein extraction buffer (50mM Tris/HCl pH 7.5 or HEPES pH 7.5, 150mM NaCl, 5% glycerol, 0.5% NP-40, cOmplete™ EDTA-free protease inhibitor tablets [Roche] - one per 10ml buffer) was added to the tissue and grinding was continued until a homogenous suspension was formed ...
-
bioRxiv - Biochemistry 2023Quote: ... then lysed in ice-cold NP-40 lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol, Roche cOmplete protease inhibitor cocktail) by trituration followed by incubation on ice for 10 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.5, 150 mM NaCl, 1 mM EDTA, 10 % [v/v] glycerol, 1 mM DTT, and 1 × complete Protease Inhibitor [Roche; Cat. No. 058929700001]) was added to homogenised plant material (100 μl extraction buffer per 100 mg plant material) ...
-
bioRxiv - Biochemistry 2023Quote: ... and collected by centrifugation at 7,500 RCF for 15 minutes and then suspended in Lysis Buffer D (20 mM HEPES pH 8, 200 mM NaCl, 5 mM imidazole, 0.5 mM Imidazole, 1x Roche EDTA free protease inhibitor). Cells were lysed using an emulsifier (AvestinEmulsiflexC3 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were suspended in Resuspension Buffer A (20 mM HEPES pH 8, 150 mM NaCl, 5% glycerol, 0.5 mM TCEP, Roche EDTA free protease inhibitor) and lysed using an emulsifier (AvestinEmulsiflexC3) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 10 ml of extraction buffer (pH 6.7) (250 mM sucrose, 120 mM KCl, 10 mM MOPS, 5 mM MgCl2, 1 mM DTT, 1 Roche protease inhibitor cocktail tablet) (Vought et al ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled tissue from each brain region was suspended in 6 ml of 0.32 M sucrose homogenization buffer (4 mM HEPES, 0.1 mM CaCl2, 1 mM MgCl2, plus Roche protease inhibitor tablet) and homogenized with a Teflon homogenizer using 10 strokes at 900 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 mM imidazole and 10 % glycerol supplemented with EDTA-free protease inhibitor tablets (Roche; 1 tablet per 100 ml buffer) and lysozyme (1 mg/ml) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatant was moved to a new 1.5 ml Eppendorf tube and 600 μl of dilution buffer and 100 μl protease inhibitor cocktail (Roche #11836153001) were added ...
-
bioRxiv - Biochemistry 2020Quote: ... dried and solubilized in 0.2 ml Hepes (100 mM) buffer containing cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) (1 tablet/20 ml of buffer solution) ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were washed twice with PBS and lysed with 6 ml of lysis buffer (8 M urea, 150 mM NaCl, 100 mM ammonium bicarbonate, pH 8; added per 10 ml of buffer: 1 tablet of Roche mini-complete protease inhibitor EDTA free and 1 tablet of Roche PhosSTOP tablet ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 mM imidazole and 10 % glycerol supplemented with EDTA-free protease inhibitor tablets (Roche; 1 tablet per 100 ml buffer) and lysozyme (1 mg/ml) ...
-
bioRxiv - Neuroscience 2021Quote: ... Coli tRNA at RT for 10 minutes and resuspended in EMSA 1X with 100 U/ml RNAse inhibitor and 1X protease inhibitor cocktail (Roche). The assay was then performed in presence of 250 ng of biotinylated transcript ...
-
bioRxiv - Physiology 2021Quote: ... and 400 ml of sample was placed in a 2-l wide-mouthed Erlenmeyer culture flask with 100 ml of freshly prepared blendzyme (Roche Liberase TM ...
-
bioRxiv - Microbiology 2022Quote: PPs were excised from the SI and digested (37 °C, 45 min) using 100 µg/ml liberase TH/DNase (Roche) in RPMI containing 5 % FCS ...
-
bioRxiv - Bioengineering 2020Quote: The cell-free reaction mixture for the KGK10 strain is identical to that used for the T7 SHuffle® with the addition of 100 μg/mL DsbC (GeneFrontier) and 3.33 Units/uL T7 RNAP (Roche). Previously prepared KGK10 extract fermented and processed by the Swartz lab was tested alongside the in-house KGK10 extract prepared by shake flasks.
-
bioRxiv - Neuroscience 2020Quote: ... To lyse the cells medium was removed and the well was washed with 2 ml ice cold PBS before 100 µl lysis buffer was applied (RIPA buffer supplemented with PhosSTOP (Roche) and protease inhibitors (cOmplete Mini ...
-
bioRxiv - Neuroscience 2020Quote: ... 18 µl cleared cell lysate or brain homogenates (20-100 µg based on Tau aggregate content) were incubated with 2 µl 1 mg / ml pronase (Roche) at 37° C for one hour ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 mM imidazole and 10% glycerol supplemented with EDTA-free protease inhibitor tablets (Roche; 1 tablet per 100 ml buffer) and lysozyme (1 mg/ml) ...
-
bioRxiv - Immunology 2019Quote: ... memory B cells were plated at 6 B cells in 55 μl per well into 96 × 384-well plates in B cell media supplemented with 100 U ml−1 IL-2 (Roche), 50 ng ml−1 IL-21 (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was removed and the well was washed with 2 ml ice cold PBS before 100 μl lysis buffer were applied (RIPA buffer supplemented with PhosSTOP; Roche) and protease inhibitors (complete Mini ...
-
bioRxiv - Microbiology 2021Quote: ... At an OD600 of 5-6 the cells were harvested at 11.325 g and 4 °C for 15 min and cell pellet of 100 ml cell culture was resuspended in 25 ml buffer A (100 mM Tris-HCl, pH 8.0) with cOmplete™ Proteinase inhibitor (Roche). Cell disruption was performed using the French Press cell with a pressure of 172 mPA for five passages ...
-
bioRxiv - Genetics 2022Quote: ... with 5mM EDTA to remove waste and epithelial cells then were minced and dissociated in RPMI containing collagenase (100 mg/ml collagenase A; Roche), DNase I (50 μg/ml ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 20 mM KCl, 2 mM MgCl2, 1% TX-100, 40U Ribolock ml-2 and protease inhibitor cocktail, Roche) followed by clearing at 17 000 × g for 10 min at +4C° ...
-
bioRxiv - Immunology 2023Quote: ... Washed small intestine pieces were then finely chopped and incubated in serum-free medium added with 100 μg/ml Liberase TL (Roche) and 50 μg/ml DNAse I (Roche ...
-
bioRxiv - Immunology 2023Quote: ... Stored synovial tissue samples were then thawed and disaggregated into single-cell suspensions by mincing and digesting with 100 µg/mL LiberaseTL (Roche) and 100 µg/mL DNaseI (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Excised tumors were cut into small pieces and digested at 37°C for 30 min with 100 μg/ml DNase I (Roche) and 200 U/ml Collagenase (Worthington) ...
-
bioRxiv - Cell Biology 2023Quote: ... The microsome fraction was solubilized in 1% Triton X-100 in PBS (10 mg microsome per ml) with protease inhibitor cocktail (complete mini, Roche) by rocking at 4°C for 60 min ...
-
bioRxiv - Neuroscience 2024Quote: Brains were dounce homogenized in RPMI (1X) + 10% Cosmic Calf Serum (Hyclone) and digested with 100 mg/mL collagenase/dispase (Roche) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... each supplemented with protease and phosphatase inhibitors (2X cOmplete, EDTA-free, Protease Inhibitor Cocktail [Roche]; 1X PhosSTOP Phosphatase Inhibitor [Roche]; 100 µg/mL Pefabloc SC [Roche]), while incubating on ice for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: HeLa cells treated with or without CsA were infected with HIV-1 (10 ng p24) that had been treated with 100 U/ml of DNase I (Roche) for 1 h at 37° C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... ear punch biopsy samples were homogenized in lysis buffer (50 mM Tris-base, 150 mM NaCl, 5 mM EGTA supplemented with EDTA-free complete protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) and 0.5% Triton X-100) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments encompassing TPP riboswitches and the first 5 codons of the downstream gene were amplified from genomic DNA by PCR using HiFi Taq MasterMix (KAPA Biosystems, Wilmington, MA, USA) and inserted in frame preceding the nanoluciferase gene in the pNBU2 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIGprobes were detected with antibodies in MABT containing 5% horse serum appropriate for NBT/BCIP in situ hybridization (Roche anti-DIG-AP 1:1000) or for FISH (Roche anti-DIG-POD 1:1000) ...
-
bioRxiv - Biochemistry 2019Quote: ... pooled together and placed in buffer H (10 mM HEPES pH 7.5, 5 mM MgCl2, 25 mM KCl, 0.25 M sucrose supplemented with Complete protease inhibitors cocktail, Roche Products Ltd, Welwyn Garden City, UK) at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell pellets were resuspended in lysis buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 5% v/v glycerol, 1 mM TCEP-NaOH, Roche protease inhibitor cocktail EDTA-free) at the ratio of 50 ml / L equiv ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subsequently incubated in antibody solution (5% Sheep serum, 1% Tween20 and 1:2500 dilution of Alkaline Phosphatase-linked α-Digoxigenin antibody, Roche, 11093274910 in TBST) for 2 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... and homogenized in 5 volumes of ice-cold PBS containing 1% NP-40 and Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland) using 2×10 clockwise strokes with 5 s rest time ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Cell Biology 2023Quote: ... and lysis buffer A (50 mM Tris-HCl, 5 mM EDTA, 10 mM NaN3, and Complete™ EDTA-free tablet; Roche Diagnostics, Mannheim, Germany); disrupted with glass beads at 4 °C ...