Labshake search
Citations for Roche :
1801 - 1850 of 7965 citations for 5 Chloro 1 benzothiophen 2 yl methanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were incubated one hour in 5% milk before adding the primary antibody (anti-HA 3F10, Roche 27573500 ...
-
bioRxiv - Neuroscience 2023Quote: ... homogenization buffer (0.32 M sucrose, 5 mM HEPES, in PBS pH=7.4, with protease inhibitor cocktail [Roche]) was added to hippocampi samples ...
-
bioRxiv - Neuroscience 2024Quote: Primary antibodies were serially applied using the U DISCOVERY 5-Plex IF procedure (Ventana Medical Systems, Roche). Ready to use DISCOVERY OmniMap anti-Rb HRP (cat ...
-
bioRxiv - Genomics 2024Quote: ... The 5’ linker ligated cDNA was then subjected to second strand synthesis with KAPA HiFi mix (Roche) using a second strand primer with an UMI of 25 nucleotides (CTACACTCGTCGGCAGCGTCN25GTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Cancer Biology 2024Quote: ... N-glycopeptides were enzymatically deglycosylated and eluted from the beads using 5 U of PNGase F (Roche) in 200 µl of 100 mM NH4HCO3 at 37 °C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail). Cell lysates were prepared by bead-beating ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1mM EGTA, 1% Triton X-100, 0.4% SDS, 1% NP-40, 1× Roche protease inhibitor cocktail), one time with wash buffer B (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail) and were lysed by beating with 0.5-mm-diameter glass beads using a FastPrep instrument at a speed of 6.5 m/s for three cycles of 20 seconds each ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM EDTA, 1 mM EGTA, 1.5 mM MgCl2, 1% Triton X-100, 10% Glycerol, 1 mM DTT, Roche complete protease inhibitor) with 0.5 mg/mL Lysozyme and placed on a roller for 45 minutes at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl, 10% sucrose, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 3 mM ATP, 1 mM PMSF and Roche protease inhibitors). Native mouse regulatory light chain (RLC ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 X protease and 1 X phosphatase inhibitors (Roche), 10 % v/v glycerol) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HA tag (Roche 11666606001, 1:1,000 or 1:3,000), His tag (Abcam ab18184 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mg.mL−1 SDS) with Complete protease inhibitors (Roche). Equal amounts of protein (BCA protein assay ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 1 mg ml-1 collagenase/dispase (Roche) and 0.1 mg ml-1 DNase I (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD68 (clone KP-1 at 1:20, Ventana- Roche), FOLR2 (OTI4G6 at 1:200 ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with collagenase D (1 mg ml−1, Roche) and DNase I (0.25 mg ml−1 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM DTT and 1 × protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% NP40) containing 1× protease inhibitor cocktail (Roche cOmplete). The lysate was cleared by centrifugation (1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... sections are incubated with DAPI (4′,6-diamidino-2-phenylindole, Cat. no. 10236276001 Roche, Switzerland) for 10 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were then digested by addition of 2 μL 20 mg/mL Proteinase K (Roche) and incubation for 2 h at 55° C ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was removed to 2 ml Eppendorf tubes and incubated with HA antibodies (Roche) for 30 min on a rotator at 4° ...
-
bioRxiv - Microbiology 2020Quote: ... using DK2371 chromosomal DNA as a template and Expand polymerase with Expand buffer 2 (Roche)/ The mutant PCR library was first transformed into PY79 by natural competence ...
-
bioRxiv - Plant Biology 2020Quote: ... 2% Triton X-100 and cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland). Samples were heated at 70 °C for 15 min with 1 x Bolt LDS sample buffer (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... 10μM stock) and KAPA HiFi hotstart ready mix (2× solution, 12.5μl + 2.5μl H2O, Roche, KK2602). PCR conditions were ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in three volumes of TKE supplemented with 2 mM DTT and PIs (Roche cOmplete). The capsids were sedimented in BSA-coated centrifuge tubes at 110,000 g at 4°C for 20 min (TLA-120.2) ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... 150 mM NaCl) containing 2% Triton X-100 and EDTA-free protease inhibitor cocktail (Roche). The resulting samples were incubated for 1 h at 4°C and spun down twice at 20,800 x g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were cultured in complete media with 30 IU/mL IL-2 (Roche, 202-IL). Media containing IL-2 was replenished daily for 10 days ...
-
bioRxiv - Immunology 2020Quote: ... The lungs were removed and infiltrated with 2 mg/ml collagenase D (Roche, Indianapolis, Indiana) and 0.2 mg/ml DNase I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... one of which was treated with 2 U of PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 1 hour ...
-
bioRxiv - Physiology 2022Quote: ... pyruvate supplemented with 2% Bovine Serum Albumin Fraction V Fatty acid free (Roche, USA/UK), 50 µM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2020Quote: ... 9ml of cold wash buffer (PBS, BSA 2% and 0.2U/μl RNase inhibitor from Roche) was added and the lysate was dounced with 10 strokes of loose pestle avoiding too much pressure and air bubbles ...
-
bioRxiv - Biochemistry 2021Quote: ... mRNA expression analysis was determined using KAPA SYBR Fast Master Mix (2×) Universal (KAPA Biosystems) in an Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2% Triton X-100 and 274 mM NaCl) containing a cocktail of protease inhibitors (Roche). Cells were lysed for 20 min on ice and centrifuged for 15 min at 17,400 r.p.m ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 2 uL of 50 mM MgSO4 and dNTPs (Roche#11-581-295-001) and thermal cycler program ...
-
bioRxiv - Genetics 2021Quote: ... 2% Triton X-100 in RIPA homogenizing buffer) supplemented with a protease-inhibitor cocktail (Roche) was used to resuspend the cells ...
-
bioRxiv - Neuroscience 2021Quote: ... and the RNA was subsequently precipitated in 2-propanol and 20 μg/μl glycogen (Roche) overnight at −20 °C ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM PMSF) supplemented with one protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Immunology 2023Quote: Anti-nucleocapsid IgG was measured using the Elecsys Anti-SARS-COV-2 assay (Roche; 09203095190) run on a Cobas e411 analyser (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... the eyes were incubated with 2% Dispase II (neutral protease; Roche Applied Science, Indianapolis, IN) in Hank’s balanced salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were washed once with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (Roche, 10236276001) in methanol (1 μg/ml) ...
-
bioRxiv - Immunology 2024Quote: ... 2 mL aliquots of peripheral blood were treated with 30mL of RBC lysis buffer (Roche) for 5-8 minutes at room temperature with gentle mixing ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 μg/mL DAPI (4,6-diamidino-2-phenylindole, F. Hoffmann-La Roche, Natley, NJ, USA) was added to counterstain the nuclei ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM beta-mercaptoethanol) in the presence of a protease inhibitor cocktail (Roche, Basel, Switzerland). These mixtures were incubated on ice for 30 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was amplified using F3 and R3 primers (Supp. Table 2) and KAPA-Hifi polymerase (Roche). Following a 1X SPRIselect bead DNA cleanup (Beckman Coulter) ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then digested with Liberase Blendzyme 2 (0.2 mg/ml, Roche Applied Science) and DNase I (20 μg/ml ...