Labshake search
Citations for Roche :
1751 - 1800 of 7965 citations for 5 Chloro 1 benzothiophen 2 yl methanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 2 μg of RNA was treated with DNase I for 30 minutes (#04716728001; Roche) and subsequently treated with 1 μl 25 mM EDTA at 70 °C for 10 minutes to inactivate DNase I ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Immunology 2023Quote: Spleens were incubated for 20 min with 2 mg/mL collagenase D (Roche, #11088858001) and then mashed through a 70-μm cell strainer ...
-
bioRxiv - Cell Biology 2023Quote: ... the stripped endothelium–Descemet’s layer was incubated with 2 mg/ml collagenase A (Roche) solution in human endothelial serum free media (SFM ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was treated with 2 mg/mL of pronase from Streptomyces griseus (Roche) in 50 mM Tris-HCl pH 7.0 for 1.5 h at 60°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
Faa1 membrane binding drives positive feedback in autophagosome biogenesis via fatty acid activationbioRxiv - Biochemistry 2023Quote: ... 2 mM MgCl2) and finally resuspended in lysis buffer containing complete protease inhibitors (Roche), an FY-inhibitor mix (Serva) ...
-
bioRxiv - Immunology 2024Quote: ... the cells (108/ml) were pretreated with 2 mM Pefabloc SC Plus (Roche #11873601001) for 15 min at 37 °C with rotation set to 10 RPM ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). AE1/AE3 (Leica Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). Glut-1 (2B scientist ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were lysed in 2% SDS buffer supplemented with complete Protease (Roche, 11697498001) and PhosSTOP phosphatase (Roche ...
-
bioRxiv - Genomics 2024Quote: ... The colony PCR was performed in 2 × KAPA HiFi DNA polymerase (Kapa Biosystems, USA) and 10μM primers under conditions of 3 min at 95 °C ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of 10x DIG labeling mix 10x DIG labeling mix (Roche, Basel, Switzerland), 0.5 µl of RiboLock RNase inhibitor (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma contamination was excluded by 4’,6-diamidino-2-phenylindole staining (Roche, Basel, Switzerland). Cell lines were authenticated by STR DNA profiling analysis (Leibniz Institute DMSZ ...
-
bioRxiv - Plant Biology 2022Quote: ... 200 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM DTT, 10 mM MgCl2, 1 × protease inhibitor cocktail from Roche) for 2 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, protease inhibitor cocktail [1 tablet in 50 mL lysis buffer, Roche]). The whole cell extract was denatured ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM EGTA and 1 mM dithiothreitol) with 1% protease inhibitor cocktail (04693116001, Roche) and diluted 1x with the 2x loading buffer (65.8 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed twice with Buffer 1 (1× eBioscience Perm/Wash Buffer, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor). The homogenate was centrifuged and the protein concentration of the supernatant was measured using a Pierce 660 nm Protein Assay Reagent (Thermo Scientific) ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs were frozen in liquid nitrogen and stored at 80 °C or directly lysed with lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 0.5% NP40, 0.5% Triron-X100, 5% glycerol, 1x Roche Complete EDTA free inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Microbiology 2023Quote: ... D311A 5’-ATA ATC CCA TTT GGC GAC GTC AAT G) using KAPA HiFi HotStart ReadyMix (Roche). Homozygous KI was confirmed by Sanger sequencing after amplification using primer SAM_Seq_Ex16_FW (5’-CAT GAA GGC TCT TCC TGC GTA A ...
-
bioRxiv - Genomics 2023Quote: ... Magnesium chloride was added to a final concentration of 5 mM and KAPA HiFi 2x ReadyMix (Roche) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Cell Biology 2023Quote: ... or ELB buffer (250 mM NaCI, 5 mM EDTA, 50 mM HEPES, 0.1% Ipegal, Roche protease inhibitor) with sonication (Qsonica ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were incubated one hour in 5% milk before adding the primary antibody (anti-HA 3F10, Roche 27573500 ...