Labshake search
Citations for Roche :
1651 - 1700 of 7965 citations for 5 Chloro 1 benzothiophen 2 yl methanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: Adenosine 5’-triphosphate (ATP) levels were assessed using an ATP Bioluminescence assay Kit (Sigma/Roche). Briefly ...
-
bioRxiv - Biophysics 2024Quote: ... 5% (v/v) Glycerol and EDTA-free protease inhibitor cocktail tablet/50 ml (Roche, UK)] ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). Samples were normalized and pooled in equimolar amounts and the pools were sequenced on the Illumina MiSeq machine with the 2 x 300 bp V3 kit at the USEQ sequencing facility (Utrecht University ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). The PCR conditions were 98°C for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... snRNA-seq 5’ libraries were balanced using a Kapa library quantification kit (Roche, Indianapolis, IN) and pooled to generate 150 base pair ...
-
bioRxiv - Systems Biology 2024Quote: ... see Supplemental Table 5) for 8 cycles with 2X KAPA HiFi master mix (Roche, 07958935001). Double stranded oligo cleanup and library cloning was performed as described above for the RPE-1 essentials library.
-
bioRxiv - Cancer Biology 2024Quote: ... 5-plex immunohistofluorescent staining was performed on the fully automated Ventana Discovery Ultra (Roche Diagnostics) using the manufacturer’s solutions and antibodies ...
-
bioRxiv - Molecular Biology 2024Quote: ... or mutant Piwi6 were transfected using 5 μL X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.3 M NaCl, 1 mM MgCl2, 10% glycerol, 1 mM EDTA, 1 mM beta-mercaptoethanol, 0.01% IGEPAL CA-630, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Genomics 2021Quote: ... Final libraries were PCR-amplified during 5 cycles with Kapa HIFI PCR kit (Roche, Basel, Switzerland) before standard library quality control with standard sensitivity NGS Fragment kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Biochemistry 2020Quote: ... 0.5mM Benzamidine) supplemented with 5 mM βME and 1x cOmpleteTM EDTA-free protease inhibitor cocktail (Roche). A similarly supplemented buffer A volume (2.5 PCV ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μL of LightCycler® 480 SYBR Green I Master Mix (Hoffmann-La Roche, BSL, Switzerland), 1.5 μL of PCR-grade water and 2.5 μL of cDNA (concentration ranged from 50 pg/μL to 500 ng/μL) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mM Na3VO4] containing a protease inhibitor cocktail (Complete EDTA-free from Roche Diagnostics, Indianapolis, IN) and a phosphatase inhibitor cocktail (2×PhosSTOP from Roche Diagnostics) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Target cells with PBMCs in complete medium or supplemented with 5% Triton X-100 (Roche Diagnostics) were used to determine minimum and maximum release ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% [v/v] glycerol) supplemented with 1x cOmplete EDTA free protease inhibitor cocktail tablet (Roche #11873580001). Cells were lysed via sonication ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked with 5% milk in TBS-T or 10% Western Blot Blocking Reagent (Roche) followed by primary antibody incubation overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by multiplex immunofluorescence staining with a U DISCOVERY 5 plex immunofluorescence (Roche Diagnostics, Meylan, France). Three sequential rounds of staining were performed each including heat deactivation step ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 mM EDTA) in the presence of phosphatase and protease inhibitors (4906837001 and 4693159001, Roche). Cell lysate was subjected to immunoprecipitation with the related antibody and agarose beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM KCl) supplemented with protease and phosphatase inhibitor cocktails (Roche, cat#05892791001 and cat#04906837001), was used to homogenize brain tissue as described previously 55 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 µl of qPCR reaction mix containing 5 ul LightCycler 480 Probes Master (Roche, Cat#04707494001), 3.4 ul of Nuclease Free H2O (Ambion ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% v/v glycerol) supplemented with HP plus protease inhibitor mix (Serva) and DNase I (Roche). Cell lysates were prepared by sonication and cleared by centrifugation at 80000g at 4°C for 30-45 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... the medium was added with 10 μL of 5 mg/mL MTT solution (Roche, Basel, Switzerland), followed by adding the formazan diluted in about 200 μL of dimethylsulfoxide (Genview ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 mM EDTA) containing 1x protease inhibitor cocktail (cOmplete™, EDTA-free Protease Inhibitor Cocktail, Roche). Cell debris was removed by centrifugation (8,000 g ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM imidazole and 500 μL cOmplete Hig-tag purification Resin (obtained from Roche, ref 05893682001). The mixture was gently shaken at 4°C for 4 h in dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... or pre-extracted for 5 minutes on ice with CSK/0.5% Triton buffer (supplemented with Roche Complete Protease inhibitor and PhosSTOP Phosphatase inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... After the membrane was blocked with 5% BSA (Bovine Serum Albumin Fraction V, Roche Diagnostics, Germany) in TBST buffer (1X Tris-Buffered saline ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 mM EDTA) containing a protease inhibitor cocktail (cOmplete™, Mini Protease Inhibitor Cocktail, Roche) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... 2.5 μL of 5 μM reverse primer and 10 μL of KAPA SYBR FAST (KAPA Biosystems). The qRT-PCR was done in CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad) ...