Labshake search
Citations for Roche :
951 - 1000 of 2467 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... the dorsal and ventral layers of the ear were split mechanically and placed dermis side down in a 24 wells plate with 500 μl/well of RPMI with 250 mg/mL of Libarase (Roche, Cat #05401054001) and 10 mg/mL of DNase I (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... we treated sensitive and resistant cells with increasing concentrations of SP600125 for 24 hours and evaluated the cell viability using the Cell Proliferation Kit I (MTT) (Roche, Cat. 11465007001) and measuring the absorbance value at λ=590nm ...
-
bioRxiv - Biochemistry 2019Quote: ... 1 % Tween-20 and 1 mM β-mercaptoethanol supplemented with 1 mg/mL lysozyme and protease inhibitor cocktail tablet (Roche, Switzerland) at 4°C ...
-
bioRxiv - Genomics 2019Quote: TUNEL staining on rat β-cells was performed 48h after transfection using the TMR red In Situ Cell Death Detection Kit (Roche) combined to polyclonal guinea pig anti-insulin (dilution 1:40 ...
-
bioRxiv - Microbiology 2020Quote: ... 20 uL was treated with β-Glucuronidase/Arylsulfatase obtained from Helix pomatia according to the manufacturer’s recommendation (Roche Catalog No. 10127698001). Liver was extracted by homogenizing a piece of liver with 1 mm stainless steel beads at 30 Hz for 5 minutes in methanol + 0.1 % acetic acid ...
-
bioRxiv - Microbiology 2020Quote: ... ifn-β and bcl-2 genes were amplified with specific primers and quantified by qPCR using a LightCycler 96 system (Roche). The mRNA levels of il-6 ...
-
bioRxiv - Plant Biology 2022Quote: ... and 1X protease inhibitor cocktail) with a combination of phosphatase inhibitors (20mM NaF, 1mM Na2MoO4, 10mM Na3VO4, 50mM β-glycerophosphate and 1X PhosStop cocktail (Roche) to preserve EIR1 phosphorylation status ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM β-mercaptoethanol and 20 μM GDP supplemented with DNase I (10 μg/ml) and cOmplete protease inhibitor cocktail tablets (Roche). Cells were mechanically disrupted using a Microfluidizer (Microfluidics International Corporation ...
-
bioRxiv - Neuroscience 2023Quote: ... threshold values for biomarker aggregation also differ (amyloid-β: 192 pg/mL for INNO-BIA AlzBio3, 980 pg/mL for Roche Elecsys ...
-
bioRxiv - Plant Biology 2022Quote: ... the samples were boiled 15 min at 95°C to gelatinize the starch and hydrolyzed with α-amylase and amyloglucosidase (Roche) to release the glucose blocks ...
-
bioRxiv - Genomics 2020Quote: ... Samples were hybridized with digoxygenin-labelled oligonucleotide probes directed to α-globin introns (30 ng per slide) and visualized using FITC-conjugated antibodies (primary: sheep anti-DIG FITC [Roche] 1:50 ...
-
bioRxiv - Cell Biology 2022Quote: ... 25 µL of these samples were resolved by SDS-PAGE and analyzed by western blotting with α-HA3 tag antibody (#3F10, Roche) for western blotting ...
-
bioRxiv - Microbiology 2023Quote: ... one half was immunoblotted with NB13 (7 µg/mL) followed by washing and probing with α-HA-peroxidase (1:1000, Roche), whereas the other half was probed with α-His-peroxidase only (1:4000 ...
-
bioRxiv - Cell Biology 2022Quote: ... of which a 40% of the final volume were resolved in a SDS-polyacrylamide gel and then transferred to nitrocellulose for α-HA (#3F10, Roche) western blotting.
-
bioRxiv - Plant Biology 2023Quote: ... Primary and secondary antibody dilutions used for immune detection were as follows: α-HA(rat)-1:2,000 (Roche Diagnostics, Basel, Switzerland), α-GFP(mouse)-1:1500 (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Immunology 2019Quote: ... After blocking for 1 hour in 3% Bovine Serum Albumin (Roche) in TBS-T ...
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... 5 mg/kg diazepam (Valium10, Roche Farma SA) and 1 mg/kg atropine (B ...