Labshake search
Citations for Roche :
9201 - 9250 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: Damage to the human colon epithelial cell line HT-29 and macrophages J774A.1 (ATCC TIB-67) were assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of LDH in the growth medium ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-Green Fluorescent Protein overnight at 4°C (Clones 7.1 and 13.1; 1:50 dilution, Roche, Mannheim, Germany) and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were in contact for 2 hours at room temperature with a mouse monoclonal primary antibody anti-BrdU (1/1000 dilution) (Roche), then rinsed and incubated for 30 min with a fluorescent secondary antibody Alexa-633nm goat anti-mouse (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... the USER digestion product was directly performed index PCR with 1 x KAPA HiFi HotStart Uracil+ ReadyMix (Kapa Biosystems, Cat.No.KK2801). Protocol of Strand Test 3 was almost same as Strand Test 2 ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Genomics 2019Quote: ... amplicons were diluted 1:100 and 1 µL was used into a 40-µL barcoding reaction using 20 µL 2x KAPA HiFi Hotstart reagents (Roche) and 80pmol each barcoded primer ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... one organoid per condition was lysed with Urea Buffer (7M Urea, 2M Thiourea, 2% CHAPS, 1% DTT (w/v) and Complete protease inhibitor cocktail (Roche) in MilliQ water) ...
-
bioRxiv - Biochemistry 2019Quote: ... were lysed with lysis buffer (25mM Tris, 150mM NaCl, 1mM EDTA, 1% NP-40, 5% Glyceral) with proteinase inhibitor cocktail (Roche) on ice for 30 min ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were washed three times with ice cold PBS and then lysed in 300 μL of 1% SDS lysis buffer with protease inhibitor cocktail (Roche). Lysates were sonicated with a Diagenode Bioruptor Plus with the following settings ...
-
bioRxiv - Biochemistry 2019Quote: ... The antibodies used for the brain-ring gland complex included a rat anti-HA high-affinity monoclonal antibody (3F10, 1:20 dilution; Roche), a guinea pig anti-Shroud antibody (67 ...
-
bioRxiv - Molecular Biology 2020Quote: MtDNA copy number was analyzed in duplicate by quantitative real-time PCR using 2 μl of 1/400-diluted SacI-treated total DNA in a 10 μl reaction containing 0.2 μM forward and reverse primers and 1× KAPA SYBR FAST qPCR Master Mix for LightCycler 480 (KAPA Biosystems) in a LightCycler 96 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... the transfected cells were lysed in 800 ul PBS with 1% Triton and protease inhibitor (Roche cOmplete EDTA-free tablets), and cleared of debris by spinning in a table-top centrifuge (Eppendorf 5424R ...
-
bioRxiv - Cell Biology 2020Quote: Trichonympha and Teranympha cells were extracted from the hindgut of termites in 10 mM K-PIPES in the presence of cOmplete protease inhibitor cocktail (1:1000; Roche) as described (Guichard et al ...
-
bioRxiv - Pathology 2021Quote: ... The sections were incubated for 1 to 24 hr in the dark at room temperature with development solution (NBT/BCIP substrate, Roche)
-
bioRxiv - Genetics 2021Quote: ... Probes were generated using primers listed in Supplementary Table 1 from the G135P65476A4 BAC as described in [8] and were labeled using the DIG-Nick Translation Mix (Roche) as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Tissues were incubated with primary antibody in dbe+ buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 2 mM EDTA, 1% BSA, 0.05% digitonin with Roche cOmplete protease inhibitor) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... 24 hours post infection cells lysed using NP-40 buffer (50 mM Tris, 150 mM NaCl, 1% Nonidet P-40, and Complete Mini protease inhibitor cocktail [Roche]). Insoluble material were removed by centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 for 48h the cells were washed twice with PBS and then lysed in PBS/1% NP40 including the cOmplete protease inhibitor cocktail 2 (Roche) and phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Plant Biology 2019Quote: ... and once in cellulase buffer (20 mM MES-KOH pH 5.5, 100mM NaCl, 1× cOmplete™ ULTRA EDTA-free protease inhibitors (Roche), 1 mM PMSF ...
-
bioRxiv - Plant Biology 2019Quote: ... The powder was ultrasonicated in extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1× cOmplete™ ULTRA EDTA-free protease inhibitors (Roche), 1 mM PMSF ...
-
bioRxiv - Biochemistry 2021Quote: ... two volumes of RIPA buffer supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Science) was added to one volume of packed worms ...
-
bioRxiv - Immunology 2020Quote: Cell lysates from flow-sorted bone marrow osteoclast progenitors grown in presence of M-CSF and RANKL over time were harvested in 1% NP40 lysis buffer containing 1X cOmplete Protease Inhibitor cocktail (Roche). Samples were separated by SDS-PAGE and transferred to nitrocellulose membrane ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Genomics 2019Quote: ... and nuclei were resuspended in RIPA buffer (1x PBS, 1% IGEPAL, 0.5% Sodium Deoxycholate, 0.1% SDS, Roche Protease Inhibitor Cocktail). The sonicated material was centrifuged at 14,000 rpm at 4°C for 15 minutes to remove cellular debris ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were lysed by scraping in 400 μL ice cold lysis buffer RIPA buffer + 1 x complete mini EDTA-free protease inhibitors (Roche Diagnostics Corporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... treatments to remove the first antibody (42) followed by overnight incubation of pooled samples with anti-FLU antibody conjugated to alkaline phosphatase (1:2000, Roche). Expression of myl7 in 28 and 55 hpf embryos was then revealed by Fast Red (Sigma ...
-
bioRxiv - Microbiology 2019Quote: Immunoprecipitation was performed using IP buffer (1% Nonidet P-40, 50mM Tris-HCl [pH 7.5], 150mM NaCl, and Complete™ protease inhibitor cocktail-EDTA (Roche)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM NaF and 1 mM Na3VO4) in the presence of complete EDTA-free protease inhibitor cocktail (Roche Life Science) for 20 min at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Physiology 2020Quote: ... Sections were then dried and covered in an alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:3000; Roche, Mannheim, Germany) in buffer B1/2.5% goat serum at 4°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: Harvested cells were resuspended in lysis buffer (50mM Tris-Cl pH 7.5, 150mM NaCl, 1mM MgCl2, 1% NP40) supplemented with protease inhibitor (Roche 11836170001) and phosphatase inhibitor cocktail (Sigma P5726 ...
-
bioRxiv - Immunology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mM EDTA at pH 8, 10% glycerol, 1 mM DTT, 0.5 mM PMSF, 0.1 mM sodium orthovanadate, and 1X Roche protease inhibitors). Collected nuclear pellets were lysed in in 1× RIPA buffer (10 mM Tris-Cl at pH 8.0 ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was carried out in 8 μl with a primer concentration of 1 μM and SYBR Green Master mix (Roche) in a Roche LightCycler 480 system ...
-
bioRxiv - Genomics 2019Quote: ... Five to six samples at a time were then multiplexed and underwent enrichment for a 43-gene targeted RNA fusion panel (Table 1) using Roche SeqCap RNA Choice target enrichment probes spanning the entirety of the gene transcripts of interest (Roche Sequencing ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% Blocking reagent + 20% Goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Roche) in the blocking buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed using the same lysis buffer as used for the ribosome profiling experiment with 1× protease inhibitor cocktail (Roche), omitting cycloheximide ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Molecular Biology 2020Quote: ... and protein extracted using RIPA buffer with protease inhibitor cocktail mix (1 Complete MINI EDTA-free protease inhibitor tablet (Roche), 25 μg/mL calpain inhibitor (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... gel pieces briefly rinsed with 50 mM AmBic and rehydrated in a small volume (10 μL) of 50 mM AmBic supplemented with 1 U PNGase F (Roche) at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed once with PBS and resuspended in ice-cold WCE buffer (10 mM Tris-HCl, 1% NP-40, 2 mM MgCl2, benzonase, cOmplete Protease Inhibitor Cocktail (Roche), 25 nM NEM where relevant ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM TCEP 10 % v/v glycerol) supplemented with 4x EDTA-free protease inhibitor cocktail tablets (Roche, cat. No. 11836153001) and 4 μg/ml DNase I ...
-
bioRxiv - Developmental Biology 2022Quote: ... before being incubated in TNTw/block for 1 hour followed by an ON incubation with anti-DIG or anti-Fluo horseradish peroxidase (Roche). Post-antibody washes and the TSA reactions were repeated as for the first probe ...