Labshake search
Citations for Roche :
7101 - 7150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The resulting sgRNA was purified using the High Pure PCR Cleanup Microkit (Roche, 498395500). 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... and probed with rat anti-HA-peroxidase 1:1000 (Roche 12013819001), mouse anti-FLAG 1:1000 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1x cOmplete Protease Inhibitor Cocktail (Roche)) and clearing the lysates for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.5% Igepal and 1x cOmplete Protease Inhibitor Cocktail (Roche)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Cell Biology 2023Quote: • PCR #1: 10 μl reactions were prepared for each sample with KAPA HiFi HotStart ReadyMix (Roche, KK2602) containing 1 μl cDNA template and 1.5 μl of 10 μM PCR1 primer mix (U6 outer ...
-
bioRxiv - Cell Biology 2023Quote: ... The oligo pool was PCR amplified according to manufacturer’s instructions (Roche, KK2502), purified by gel extraction (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and complete protease inhibitor cocktail (Roche). Bio-Rad protein assay was used to determine the protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X COMPLETE protease inhibitor (Roche) and 0.8 mM PMSF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Two brains were transferred to a pre-chilled 30-mL glass tube Wheaton homogenizer containing 5 mL of cold ‘solubilisation-plus’ buffer (solubilisation buffer with 1X COMPLETE protease inhibitor and 1X PhosSTOP phosphatase inhibitor (Roche)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1x EDTA-free protease inhibitor cocktail (Roche), + 100mM Iodoacetamide) ...
-
bioRxiv - Cell Biology 2023Quote: ... the section was treated by proteinase K (20 μg/mL; Roche, Swiss) for l0 min to make the cell membrane permeable ...
-
bioRxiv - Cell Biology 2023Quote: Antibodies were applied in the following dilutions: mouse a-GFP (1:1000) (Roche), rat a-HA (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Cell Biology 2023Quote: ... rat a-HA (1:2000) (Roche), rabbit anti-aldolase (1.2000 ...
-
bioRxiv - Biophysics 2023Quote: ... and protease inhibitor cocktail (Roche) before cell lysis by sonication using a microprobe tip set to 35% amplitude ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 30 seconds at 72°C) in a LightCycler 480 (Roche). Quantification was carried out in parallel for each of the target genes and the reference gene ...
-
bioRxiv - Cell Biology 2023Quote: ... or Expand Long Template PCR system (Roche/Sigma) and the oligonucleotides ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 x cOmplete protease inhibitor cocktail without EDTA (Roche), and 1 µM Cmd1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mg DNase I (Roche) and triton X-100 to 1% were added ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH 7.4) complemented with protease inhibitor cocktail (Roche #11697498001). Total soluble proteins were measured using BCA Protein Assay Kit (Thermo Scientific #23227) ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Immunology 2023Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The sequencing libraries were multiplexed and clustered onto a flowcell ...
-
bioRxiv - Immunology 2023Quote: Total RNA was isolated from BMDM using the TriPure reagent protocol (Roche Life Sciences). Isolated RNA was re-suspended in RNase/DNase-free water (Wisent) ...
-
bioRxiv - Genomics 2023Quote: ... RNAse inhibitors (Roche Diagnostics, # 03335402001) were added to all buffers (1U/ul) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mg/ml DNaseI (10104159001; Roche), 5 mM CaCl2 and 0.9 mM MgCl in HBSS] sequentially ...
-
bioRxiv - Biophysics 2023Quote: ... SYBR Green mix (Roche, LightCycler 480 I Master). To normalize the cDNA amount among different conditions ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: ... EDTA-free protease inhibitors (Roche #11873580001) for 30 min on ice before centrifugation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 complete-EDTA protease-inhibitor tablets (Roche) per 500 mL ...
-
bioRxiv - Genomics 2023Quote: ... The KAPA Library Quantification DNA Standards #1–5 (Roche #07960387001) were used for the standard curve ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X complete protease inhibitor cocktail (complete Mini EDTA-free, Roche) and 2.5U/μL benzonase nuclease (Novagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a LightCycler 480 II System (Roche Diagnostics) in 96-well-plate format ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with cOmplete cocktail (11873580001, Roche), 20 mM NEM and 30 mM IAA) ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with cOmplete cocktail (11873580001, Roche), 20 mM NEM and 30 mM IAA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were harvested in 1X PBS supplemented with protease inhibitors (cOmplete cocktail, 11873580001, Roche). Cells were centrifuged at 3,000 rpm for 10 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.25% Triton X-100 supplemented with cOmplete cocktail (11873580001, Roche), 20 mM N-ethylmaleimide (NEM ...
-
bioRxiv - Molecular Biology 2023Quote: ... cell lysates were prepared in the presence of cOmplete cocktail (11873580001, Roche) and 20 mM N-ethylmaleimide (NEM ...
-
bioRxiv - Cell Biology 2023Quote: ... UltraMap-anti-Rb HRP (Roche Tissue Diagnostics). Fluorescent detection was performed using an Opal fluorophore tyramide-based signal amplification system (Akoya Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary-secondary-antibody pairs were as follows: Ki67 (Roche Tissue Diagnostics, 05278384001), OmniMap-anti-Rb HRP (Roche Tissue Diagnostics) ...
-
bioRxiv - Cell Biology 2023Quote: ... fully automated multiplex immunofluorescent staining was performed on the Ventana Discovery Ultra platform (Roche Tissue Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... OmniMap-anti-Ms HRP (Roche Tissue Diagnostics); UBF1(Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... OmniMap-anti-Ms HRP (Roche Tissue Diagnostics); MINA (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... OmniMap-anti-Rb HRP (Roche Tissue Diagnostics); pan-CKAE1-AE3 (Leica Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: Apoptotic cells were identified by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) staining using the In Situ Cell Death Detection Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... HepG2s were washed once with 1X PBS then lysed in SDS lysis buffer (50 mM Tris HCl/2% SDS/5% glycerol/5 mM EDTA/1mM NaF/dH2O) supplemented with cOmplete Protease Inhibitor Cocktail Tablets (Roche #11836170001), Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich® #P5726) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were quantified by qPCR using the Kapa Library Quantification Kit (Roche; Cape Town, South Africa), and the pooled library (from 27 RNA samples ...
-
bioRxiv - Physiology 2023Quote: ... the slides were placed in the terminal dUTP-nick-end labelling (TUNEL) solution (labelling with either fluorescein or tetra-methyl-rhodamine; Roche Diagnostics GmbH, Mannheim, Germany) in 37°C for 1 h and covered in Vectashield with DAPI (Vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... mycoides DNA with a Nick Translation Kit (Roche; 10976776001) according to the manufacturer’s instructions ...