Labshake search
Citations for Roche :
7251 - 7300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Complete Protease Inhibitor Cocktail (Roche)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-HA (1:50, Roche 3F10), mouse anti-HA (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... followed by 25 cycles of PCR using KAPA HiFi master mix (KAPA Biosystems) using G115 WT TCR in pMIG as template ...
-
bioRxiv - Genomics 2023Quote: ... 0.1% SDS) with 1x cOmplete EDTA free protease inhibitor cocktail (Roche, 11873580001), and sonicated for 6 cycles of 30s ON/30s OFF on high power using the Bioruptor Plus (Diagenode) ...
-
bioRxiv - Genomics 2023Quote: ... The concentration of the library was quantified using a KAPA Library Quantification Kit (Roche, KK4824). The library mixed with 5% PhiX or other high-complexity libraries was loaded on a S4 lane of NovaSeq 6000 system ...
-
bioRxiv - Genomics 2023Quote: ... followed by TriPure (Roche, Cat. No 11667165001) purification to ensure all RNAs used in the reaction contained biotin.
-
bioRxiv - Microbiology 2023Quote: ... Final library pool concentrations were quantified with Kapa library quantification (Roche) and sequenced on an Illumina MiSeq.
-
bioRxiv - Microbiology 2023Quote: ... 1X antibiotic-antimycotic) with 100 U/mL recombinant interleukin (IL)-2 (Roche #11147528001) and activated or frozen in freezing media (90% FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were lysed with TNE-lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP40, and complete Protease Inhibitors, Roche) for 30 min on ice then spun down at 11,000 rpm for 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fab fragments antibody (Roche, 11426339810) was added (1:2000 dilution in PBT + 2 mg/ml BSA + 2% sheep serum ...
-
bioRxiv - Developmental Biology 2023Quote: Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed using the In Situ Cell Death Detection Kit (11684795910, Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryos were fixed in freshly made 4% PFA in PBS with PhosSTOP™(Roche, 4906845001) overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... we incubated slices with the secondary antibody (Alexa 488 donkey-anti-chicken, Immuno Jackson, 703-545-155) and DAPI (Roche, 10236276001) for 2h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Expi293F cell pellets (from 50 ml of culture) were thawed and resuspended in 8 ml of 0.25 x PBS with protease inhibitors (Roche, Indianapolis, USA). Cells were lysed using a Dounce homogenizer on ice and then centrifuged in a Beckman SW55 rotor at 100,000xg for 45 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5% Na-deoxycholate) containing protease inhibitor (Roche). Protein concentration was measured by using the Bradford assay ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM Trolox) and protease inhibitors cocktail (PIC, Roche) in radioimmunoprecipitation assay (RIPA ...
-
bioRxiv - Cell Biology 2023Quote: ... Disaggregation of zebrafish cells was done using the liberase enzyme (Roche). Incubation at room temperature for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: RPE-1 cells were trans-fected with the different Flag constructs for 48 h using X-tremeGENE 9 DNA reagent (Roche). Cells were lysed in 25mM Tris (pH 7.5) ...
-
bioRxiv - Cell Biology 2023Quote: ... Fig-ure 3D,F,J) or 48 h (for Figure 4H) using X-tremeGENE 9 DNA reagent (Roche) following the manufacturer’s instruc-tions ...
-
bioRxiv - Cell Biology 2023Quote: ... Standard PCR reactions were performed using KAPATaq DNA polymerase (Kapa Biosystems). PCR products used for cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... for thiAp-FLAGcopA or an anti-GFP antibody (11814460001, Roche Diagnostics) for thiAp-arfA-GFP and an anti-actin monoclonal (C4 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 mM 1,4-dithiothreitol (Roche) were added prior to boiling the samples at 95 °C for 10 minutes and centrifugation at 2’000 rpm for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... DRG were incubated for 1 hour at 37 °C with 1 mg/ml dispase II (Roche) and 2 mg/ml collagenase A (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 mg/ml collagenase A (Roche) prepared in HBSS ...
-
bioRxiv - Neuroscience 2023Quote: ... containing both protease and phosphatase inhibitors (#11836170001, Roche). To determine the protein concentration of each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... islets were isolated by collagenase distension through the bile duct (Collagenase P [Roche, Basel ...
-
bioRxiv - Cell Biology 2023Quote: ... Data acquisition was done using the LightCycler480 machine (Roche) and Quant Studio 5 (Fisher Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The frozen tissue was placed in an Eppendorf homogenizer (Kontes749520-0000) and then 25 µl of homogenization buffer (10mM Tris with Roche complete protease inhibitor) was added and the sample homogenized for several minutes before an additional 10µl of homogenization buffer was added again and re-homogenized ...
-
bioRxiv - Neuroscience 2023Quote: ... An electrochemiluminescence immunoassay was used to measure salivary cortisol concentrations (Cobas e 601, Roche Diagnostics, Numbrecht, Germany). The intra- and interassay variations for cortisol were below 10%.
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative real-time polymerase chain reaction (qPCR) was performed using a FastStart Universal Probe Master (Rox) kit (Roche Applied Science) or Luna Universal Probe qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μl reactions were prepared for each sublibrary with the KAPA HiFi PCR Kit (Roche, KK2502) containing 0.5 μl of the oligo pool resuspended to 20 ng/μl ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection of plasmid DNA was performed using X-tremeGENE™ HP (Roche) and siRNAs were transfected using RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μl reactions were prepared for each sublibrary with the KAPA HiFi PCR Kit (Roche, KK2502) containing 0.5 μl of the oligo pool resuspended to 20 ng/μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mg/mL Collagenase/Dispase (Roche), and 25 U/mL DNase (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1x phosphatase inhibitor cocktail (PhosphoSTOP, Roche). The extract was cleared by centrifugation and protein concentration was determined by Bradford assay (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1x complete protease inhibitor (Roche) and 1x phosphatase inhibitor cocktail (PhosphoSTOP ...
-
bioRxiv - Cell Biology 2023Quote: ... Clarified lysate was loaded onto a cOmplete His-tag purification column (Roche), immobilized proteins washed with lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... (Ventana, Roche) or Novolink Polymer ...
-
bioRxiv - Immunology 2023Quote: ... (Ventana, Roche) or DAB solution (Dako ...
-
A laboratory framework for ongoing optimisation of amplification based genomic surveillance programsbioRxiv - Genomics 2023Quote: ... according to manufacturer’s instructions or the MagNA Pure 96 instrument (Roche) with MagNA pure 96 DNA and Viral NA Small Volume Kit (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-HA (#11867423001, Roche), anti-Myc (#M4439 ...
-
bioRxiv - Microbiology 2023Quote: ... Data were analyzed with the LightCycler® 480 Software (v1.5) (Roche).
-
bioRxiv - Cancer Biology 2023Quote: ... we used 12.5 μl KAPA HiFi HotStart ReadyMix (Roche, 07958935001), 0.75 μl forward primer (5’ CTTGTGGAAAGGACGAAACACCG 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and alkaline phosphatase (AP)-conjugated streptavidin (Roche Diagnostics, UK) were added to the wells and incubated for 1 h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... and protease inhibitors (cOmplete™ Protease Inhibitor Cocktail, Roche). Proteins were quantified and separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5% NP-40) containing protease inhibitors (Roche, 04693124001). Cells were first lysed mechanically by pipetting up and down several times in a microcentrifuge tube and incubated on ice for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.4 mg/ml DNase I (#11284932001, Roche) to obtain single cell suspensions.
-
bioRxiv - Cancer Biology 2023Quote: ... the T cells were activated in X-VIVO 15 containing 150 U/mL of human IL-2 (#Ro 23-6019, Roche, Switzerland), 10 ng/mL of recombinant IL-7 (#200-07 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 250 U/mL DNase 1 (#10104159001, Roche, Switzerland) in a buffer containing HBSS with Ca2+/Mg2+ (#14205-050 ...