Labshake search
Citations for Roche :
6551 - 6600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... We included digoxigenin-11-UTP (Roche) during riboprobe synthesis ...
-
bioRxiv - Developmental Biology 2023Quote: ... Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Developmental Biology 2023Quote: ... complete Protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the resulting cDNA was examined by real-time PCR (LightCycler 480 II, Roche). The cycle threshold (Ct ...
-
bioRxiv - Developmental Biology 2023Quote: ... in the presence of NBT/BCIP substrate (Roche). After ISH ...
-
bioRxiv - Developmental Biology 2023Quote: ... the mRNAs and LNA probes were labelled with digoxigenin (Roche). Hybridized probes were detected using an alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... Hybridized probes were detected using an alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche, 1:2000) in the presence of NBT/BCIP substrate (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM PMSF and 1X cOmplete Protease Inhibitor Cocktail (11836170001, Roche) at 2-bed volumes of the pellet ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase IV (all Roche Diagnostics; Indianapolis, IN) mixed in 2% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2023Quote: ... The powder obtained was resuspended in RIPA buffer supplemented with complete protease inhibitory tablets (Roche). Afterwards ...
-
bioRxiv - Immunology 2023Quote: ... B-R18 labelled A1 EVs were resuspended in PBS buffer (0.2 M NaCl) containing a protease inhibitory cocktail (Complete Protease Inhibitory Tablets, Roche) and were stored at −20°C.
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Immunology 2023Quote: ... RT-PCR was analyzed using a LightCycler 96 Instrument (Roche Diagnostics) with thermal cycling conditions as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were syringe lysed in lysis buffer (8M urea, 50mM EPPS pH 8.5, 150mM NaCl, and Roche protease inhibitor tablet) and the resulting lysates were cleared via centrifugation.
-
bioRxiv - Cell Biology 2023Quote: ... The RT product was amplified by LightCycler 480 Real-Time PCR system (Roche) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas exome was captured using the SeqCap Epi Enrichment System protocol (Roche Sequencing Solutions, Inc.) 47 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and detected by BCIP/NBT or BM-Purple (Roche). The probes described previously are as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... All antisense probes were labeled with digoxigenin (Roche) and detected by BCIP/NBT or BM-Purple (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... labelled RNA probes were achieved by reverse transcription and purification of the amplified partial coding sequence of selected genes with a DIG RNA labelling kit (Roche, Switzerland). For 75 and 150 hpf larvae ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by an NBT/BCIP reaction (Roche). Images of whole-mount samples were taken using a Leica DMI 4000B microscope equipped with a Leica DFC 420C camera ...
-
bioRxiv - Immunology 2023Quote: ... TaqMan-based qPCR was performed using EagleTaq Universal Master Mix (Roche, 7260288190), and data were acquired on a StepOnePlus (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... Purified DNA was then pre-amplified with indexed primers and HiFi HotStart Polymerase Ready Mix (KAPA Biosystems). After estimation of additional PCR cycles required110 ...
-
bioRxiv - Microbiology 2023Quote: ... we amplified the V3-V4 hypervariable region of the 16S rRNA gene via PCR with Hifi Hotstart Readymix (Kapa Biosystems; Boston, MA), forward primer 5’-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG CCT ACG GGN GGC WGC AG-3’ ...
-
bioRxiv - Immunology 2023Quote: ... containing 250 μg/ml liberase (Roche) and 100 μg/ml DNase I (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... All samples were scanned with the Ventana DP200 (Roche, Basel, Switzerland) and processed with the Image Viewer MFC Application ...
-
bioRxiv - Immunology 2023Quote: ... RNA-Seq library was prepared according to KAPA mRNA HyperPrep kit with 200-300 bp insert size (Roche) using 250 ng of total RNAs as input ...
-
bioRxiv - Immunology 2023Quote: ... or by Roche CT/NG amplicor kit followed by concentration of positive samples using a QIAamp DNA Mini Kit (Andreasen et al. ...
-
bioRxiv - Physiology 2023Quote: ... and penicillin/streptomycin (#11074440001; Roche) and incubated for 1 h and 40 min in 6 cm cell culture dishes (Greiner Bio-One GmbH ...
-
bioRxiv - Physiology 2023Quote: ... and penicillin/streptomycin (#11074440001; Roche) and fully supplemented EBM (50%:50%) ...
-
bioRxiv - Systems Biology 2023Quote: ... pH 8.0 supplemented with protease inhibitor (cOmplete mini EDTA-free, Roche). Cells were heated at 95C and sonicated with a Bioruptor Plus (Diagenode ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... 0.5 % sodium deoxycholate) supplemented with complete protease inhibitor (Roche Diagnostics, Basel, Switzerland) and phosphatase inhibitor (PhosStop ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The qRT-PCR was performed using KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems) with StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... quantified by qPCR using KAPA Library Quantification Kit Illumina (KAPA BIOSYSTEMS #KK4824), and analyzed by paired-end sequencing using Illumina MiSeq.
-
bioRxiv - Synthetic Biology 2023Quote: ... quantified by qPCR using KAPA Library Quantification Kit Illumina (KAPA BIOSYSTEMS #KK4824), and analyzed by paired-end sequencing using Illumina MiSeq.
-
bioRxiv - Neuroscience 2023Quote: ... RNase A (Roche), Proteinase K (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and several immunohistochemistry reactions were performed in an automated immunostaining platform (Autostainer Link 48, Dako; Ventana Discovery XT, Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... (low or high pH buffer, Dako; CC1m, Ventana, Roche) and endogenous peroxidase was blocked (peroxide hydrogen at 3%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1M containing protease inhibitor (Roche). Lysate was incubated on ice for 30 min and subsequently centrifuged at 7000 xg for 10 min at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1x Protease inhibitor (Roche) by incubating on ice for 20 min followed by 10 min centrifugation at 13 k rpm to separate protein lysate from the cell debris ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR assay was prepared using KAPA SYBR® FAST qPCR Kit (Kapa Biosystems, MA, USA) and performed on an Applied Biosystems ViiA™ 7 Real-Time PCR System according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following antibody dilutions were made: fluorescein anti-dig FAB fragments (Roche cat. no. 11207741910) 1:20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and supplemented with cOmplete protease inhibitor (Roche) for 30 minutes on ice with pulse-vortexing every five minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase I (Roche Diagnostic, Indianapolis, USA) (0.2mg/mL) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Pronase (Roche Diagnostic, Indianapolis, IN, USA) (0.2mg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was incubated with mouse polyclonal anti-GFP antibody (Roche, Mannheim, BW, Germany) (1:1000 in PBST 5% fat-free milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1mM PMSF (PanReac AppliChem, Barcelona, Spain) and EDTA-free protease inhibitor complex (cOmplete Tablets EDTA-free, Roche, Mannheim, BW, Germany). After cell lysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... The concentration of each library was determined using the KAPA Library Quantification Kit (Roche, Basel, Switzerland) for Illumina platforms ...
-
bioRxiv - Molecular Biology 2023Quote: ... Viral loads were measured at all study visits using the Roche Cobas Taqman HIV-1 Test v2.0 (Roche Diagnostics, Branchburg, NJ, USA). CD4 T cell counts were also enumerated at all study visits using the 4-colour MultiTEST/Trucount assay (Becton Dickinson ...
-
bioRxiv - Molecular Biology 2023Quote: ... BSA fraction V (2% wt/vol) (Roche Diagnostics), 2-mercaptoethanol (50 µM) ...