Labshake search
Citations for Roche :
6501 - 6550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... HA-tagged pUL97 kinase was immuno-precipitated from transfected HEK 293T cells using the rat anti-HA antibody clone 3F10 (Roche). Kinase inhibitors were added to the kinase reactions at final concentrations of 1 μM (CDKIs ...
-
bioRxiv - Microbiology 2023Quote: ... LightCycler v.4.1 (Roche) for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche), and the total volume of head kidney samples was adjusted to 350 μL by adding MagNA Pure LC RNA Isolation Tissue Lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... incubated with anti-HA (Roche) antibody ...
-
bioRxiv - Microbiology 2023Quote: The qRT-PCR experiments were performed using specific oligonucleotide primers and hot-start polymerase (SYBR Green Fast Master Mix; Roche Diagnostics, Germany). The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad ...
-
bioRxiv - Microbiology 2023Quote: ... and 2.5% Na deoxycholate) supplemented with both a protease and phosphatase cocktail inhibitor (Roche, Germany). Ten μg of protein were loaded onto 10% SDS polyacrylamide gels ...
-
bioRxiv - Microbiology 2023Quote: ... phage lysates were treated with RNase A (Roche; 1 μg/mL), DNase I (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The upper aqueous phase was collected and mixed with 700 µl chloroform (Roth, 7331) and glycogen (Roche, 10 901 393 001). The RNA was then precipitated at -20°C for 16 h and pelleted by centrifugation at 4600×g for 33 min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and protease (Roche, 04 693 116 001) inhibitors ...
-
bioRxiv - Immunology 2023Quote: ... and insulin were measured by automated chemiluminescence immunoassay (ADVIA Centaur XP, Roche, Rotkreuz, Switzerland); serum luteinizing hormone (LH ...
-
bioRxiv - Immunology 2023Quote: ... glucose were measured by automated enzymatic colorimetric assay (Cobas, Roche, Germany). The area under the curve (AUC ...
-
bioRxiv - Immunology 2023Quote: ... 0.05 mg/ml Liberase TL (Roche), 0.05% DNaseI (Roche ...
-
bioRxiv - Immunology 2023Quote: ... in a plate and mechanically disrupted using the back-end of a syringe before addition of 50 μL of a digestion media (dRPMI = naRPMI supplemented with 11x collagenase D (#11088866001, Roche, Woerden ...
-
bioRxiv - Immunology 2023Quote: ... 0.05% DNaseI (Roche) and shaken at 200 rpm for 30 min at 37°C in 50-ml Falcon tubes ...
-
bioRxiv - Immunology 2023Quote: ... and 1:8000 secondary anti-DIG-PO antibodies (Roche) were added ...
-
bioRxiv - Immunology 2023Quote: ... and the LightCycler 480 System (Roche). All primer sequences used are listed in Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: Islets were isolated using collagenase P (Roche, Basel, Switzerland) and Histopaque-1077 density gradients (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... Blood glucose levels were measured in mice with glycosuria (>110 mmol/L) using Advantage II Glucose strips (Roche). Animals displaying two consecutive blood glucose measurements of ≥ 15mmol/L were considered diabetic.
-
bioRxiv - Immunology 2023Quote: ... was mixed with a DNA SYBR Green I Master Mix (Roche) on a LightCycler machine (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... pH 7.6) containing 1 mM PMSF (SERVA) and protease inhibitory cocktail (Roche). Cell lysis was performed on ice for 25 min and then precleared by centrifugation at 14000 g for 10 minutes at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... on a LightCycler machine (Roche). All gene expression levels were normalized to GAPDH ...
-
bioRxiv - Immunology 2023Quote: ... on an LC96 instrument (Roche, Indianapolis, IN) with identical experimental conditions ...
-
bioRxiv - Immunology 2023Quote: ... and quantified on a LightCycler 480 instrument (Roche, Indianapolis, IN). Primers and probes are described in36.
-
bioRxiv - Immunology 2023Quote: ... the genomic library was fully amplified using the SYBR qPCR Master Mix with primers included in the Illumina Library Quantification kit for Bio-Rad iCycler (KAPA Biosystems). Libraries were sequenced on the Illumina NextSeq 2000 using 60-nt paired-end Illumina chemistry ...
-
bioRxiv - Immunology 2023Quote: ... digested and single cell suspensions prepared using a mixture of collagenase/Dnase (Roche) prior to homogenation on a 100 mM filter using a butt-end of a syringe ...
-
bioRxiv - Immunology 2023Quote: ... quantified using the KAPA Library Quantification Kit (Roche), and submitted for sequencing on an Illumina HiSeq using 125 base pair single end reads.
-
bioRxiv - Microbiology 2023Quote: ... on a Roche LightCycler 480 System (Roche Applied Science, Mannheim, Germany). Primers used for qPCR were followed ...
-
bioRxiv - Microbiology 2023Quote: ... and resuspended in 1× TBS supplemented with the cOmplete™ Protease Inhibitor Cocktail (Roche). Resuspended cells were aliquoted into FastPrep® 2 ml Lysing Matrix tubes (MPBio ...
-
bioRxiv - Immunology 2023Quote: ... with DNase I (Roche) in RPMI 1640 supplemented with 2% FBS ...
-
bioRxiv - Immunology 2023Quote: Cell pellet or tissue were lysed in RIPA lysis buffer containing 1× proteinase inhibitor cocktail (Roche, 5056489001), 2 mM PMSF and 1 mM DTT ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) and Ct values were recorded by QuantStudio 7 Flex FStepOne Plus Cycler ...
-
bioRxiv - Immunology 2023Quote: ... the lung was insufflated past total lung capacity with a digestion solution (1.5mg/ml of Collagenase A (Roche) and 0.4mg/ml DNase I (Roche ...
-
bioRxiv - Immunology 2023Quote: ... DNaseI (Roche) and Standard Rabbit Complement (Cederlane ...
-
bioRxiv - Immunology 2023Quote: ... and (187.5 μg/ml) DNaseI (Roche)) for 75 minutes at 37°C under 1400 rpm of shaking ...
-
bioRxiv - Immunology 2023Quote: ... and 0.4mg/ml DNase I (Roche) in HBSS plus 5% fetal bovine serum and 10mM HEPES) ...
-
bioRxiv - Genomics 2023Quote: Total RNA libraries were prepared using the KAPA mRNA HyperPrep Kit (Roche Diagnostics) following the manufacturer’s manual ...
-
bioRxiv - Immunology 2023Quote: ... 1% Triton X-100) containing 1×EDTA-Free Protease inhibitor cocktail (Roche) and 1 mM PMSF (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... and Complete Protease Inhibitors (Roche). Total lysates were kept on ice for 20 min and then centrifuged at 16,000 g for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 mg/mL DNAse I (Roche) and 1 mg/mL collagenase D (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and 1 mg/mL collagenase D (Roche)) and digested in a 37°C orbital shaker under maximum rotation for 30-45 mins ...
-
bioRxiv - Immunology 2023Quote: ... RNA was reversed transcribed using the Transcriptor First Strand Kit (Roche). qPCR was carried out using SYBR Green on a LightCycler 480 (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... or by the High Pure RNA isolation kit (Roche) and subsequently quantified using the NanoDrop 8000 spectrophotometer (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and an additional step 72°C for 10 min performed on a Light Cycler 480 with the SYBR Green I Master kit (Roche) (qPHD UM2/GenomiX Platform ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Genetics 2023Quote: ... using a MagNA Lyser (Roche Diagnostics). RNA was cleaned up with the NucleoSpin RNA II kit (Macherey-Nagel ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse-anti-BrdU (1:500; Roche, 11170376001), rabbit-anti-DCX (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and nitro blue tetrazolium chloride (NBT, [Roche]).