Labshake search
Citations for Roche :
6401 - 6450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... EDTA-free (Roche) then clarified by centrifugation ...
-
bioRxiv - Biophysics 2023Quote: ... then harvested in PBS containing protease inhibitor cocktail (complete protease inhibitor; Roche, Mannheim, Germany) and phosphatase inhibitors (1 mM NaVO4 and 10 mM NaF) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Indexed libraries were quantified by qRT-PCR using a commercially available kit (Roche KAPA Biosystems Cat# KK4854). The quality of cDNA samples was verified with a bioanalyzer (Agilent Technologies 2100).
-
bioRxiv - Molecular Biology 2023Quote: ... were purchased from Roche (Germany). AlexaFluor488-conjugated goat anti-mouse antibody (1:200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1% sodium deoxycholate) with 0.1% SDS and protease inhibitors (11836153001, Roche). In all cases ...
-
bioRxiv - Molecular Biology 2023Quote: ... then subject to second-strand synthesis using 1.5 μl biotinylated oligo (10 μM) and 25 μl KAPA Hi-Fi hot start ready mix 2x (KK2601, Roche). Second strand reactions were incubated at 95°C for 3 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysis buffer (50 mM Tris-HCl, pH 7.5; 500 mM NaCl; 10 mM imidazole; 0.5 mM TCEP; 1X Roche cOmplete protease inhibitors ...
-
bioRxiv - Immunology 2023Quote: ... cOmplete protease inhibitor cocktail (Roche), and PhosSTOP phosphatase inhibitor cocktail (Millipore Sigma) ...
-
bioRxiv - Immunology 2023Quote: Cells and tissues were lysed in NP-40 lysis buffer or SDS lysis buffer supplemented with protease inhibitor (Roche, 04693159001) and then centrifuged at 4 °C to obtain cellular lysate ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA templates were subjected to in vitro transcription with DIG (cat#11277073910)-RNA labeling mix and T3 RNA polymerase (cat#11031163001) according to the manufacturer’s instructions (Roche Applied Science). Fluorescent in situ hybridization (ISH ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were done using Taq DNA polymerase (Roche Life Science or Thermo scientific) according to the manufacturer’s recommendations and using 1 μl of cDNA as a template with the following program ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM Benzamidine and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche)) and incubated on ice for 10 min ...
-
bioRxiv - Plant Biology 2023Quote: ... and 1x Protease Inhibitor Cocktail (Roche)) ...
-
bioRxiv - Plant Biology 2023Quote: ... in 100μl extraction buffer (Tris-HCl 50 mM pH 6.8, SDS 2%, DTT 2 mM and 1× protease inhibitors (Roche) and centrifuged for 5 min at 13,000g at 4OC ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA extracts were tested by RT-PCR using the Titan One Tube RT-PCR kit (Roche) and the primers of Li et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed in a LightCycler480 II (Roche Diagnostics International AG ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA sequencing libraries were prepared on a Beckman Coulter Biomek i7 liquid handling platform using Roche Kapa mRNA HyperPrep strand specific sample preparation kits (Roche 08098123702) from 200 ng of purified total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... antibodies (1:2000, Roche). The ACTIN loading control was detected using anti-ACTIN C4 mouse antibody (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were cut and immunodetected with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche) or HRP-conjugated Flag M2 (1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each brain with known weight was homogenized at 4°C using automated homogenizer and with IX RIPA buffer containing protease inhibitor tablet (Roche, Germany). After that the brain lysates were centrifuged at 12,000 rpm for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were counterstained with DAPI (1:1000; Roche). Slides were mounted and cover-slipped using ProLong Diamond antifade mountant (Thermo) ...
-
bioRxiv - Neuroscience 2023Quote: ... RT - qPCR was performed on the LightCycler 480 (Roche) using the TaqMan FAST Universal Mastermix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Salivary cortisol concentrations were measured with electro-chemiluminescence-assay (ECLIA) kit (Cobas®, Roche Diagnostics GmbH, Mannheim, Germany). Samples (IDs ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: ... On the fifth day, harvest the cells with RIPA buffer (R0278, Thermo) with proteinase inhibitors (11836170001, Roche) and phosphatase inhibitors (04906837001 ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: ... and phosphatase inhibitors (04906837001, Roche) on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... and KAPA SYBR Fast qPCR reagents (KAPA Biosystems) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1x EDTA-free protease inhibitor cocktail (Roche), 0.01% digitonin] for 10 minutes on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1x EDTA-free protease inhibitor cocktail (Roche), 0.01% digitonin] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1x EDTA-free protease inhibitor cocktail (Roche)] using a dounce homogenizer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, and 1x cOmplete EDTA-free protease inhibitor cocktail [Roche]), and washed again in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, and 1x cOmplete EDTA-free protease inhibitor cocktail [Roche]), and washed again in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were transfected with Tau P301L-V5 encoding full length human tau with P301L mutation and V5 tag (GKPIPNPLLGLDST) and TFEB-GFP at a 2:1 ratio of tau:TFEB (X-tremeGENE 9, Roche). 24 hours later the media was changed and 40 µL of Pff was added to the culture along with 200 nM Bafilomycin (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 µM PMSF and protease inhibitor cocktail (Roche) (80 µl/well) ...
-
bioRxiv - Neuroscience 2023Quote: ... protease inhibitor tablets (Roche, Basel, Switzerland, Cat# 11836170001). Protein concentration was estimated using 4% copper sulfate and bicinchoninic acid (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with Anti-DIG-AP (Roche) at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... protease inhibitor cocktail (Roche, 04693159001), and phosphatase inhibitor (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and phosphatase inhibitor (Roche, 04906837001). Lysates were centrifuged for 10 min at 4,000 g ...
-
bioRxiv - Neuroscience 2023Quote: ... After standard pretreatment in CC1 buffer (Roche), sections were incubated with rabbit anti-HDGF antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... and the KAPA Library Quantification Kit - Illumina/ABI Prism (Roche Sequencing Solutions ...
-
bioRxiv - Microbiology 2023Quote: ... A rat antibody recognizing HA was used (Roche, 11867423001, 1:250) to visualize HA-tagged CA Rab9a ...
-
bioRxiv - Microbiology 2023Quote: ... and the KAPA Library Quantification Kit -Illumina/ABI Prism (Roche Sequencing Solutions ...
-
bioRxiv - Microbiology 2023Quote: ... Respiratory viruses were detected from specimens by real-time PCR and reverse transcription (RT)-PCR assays with LightCycler instruments (Roche, Basel, Switzerland) as previously described (22 ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Biochemistry 2023Quote: ... EASY-pack protease inhibitor cocktail tablets (Roche, Basel) according to instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were incubated with two lysis buffers containing a complete protease inhibitor cocktail (Roche, 11697498001) (Paro Rinse 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and washing in DPBS then lysed in RIPA buffer (Thermo) supplemented with cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche) and 2 U/mL benzonase nuclease (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified and assessed using the Kapa Library Quantification Kit (Kapa Biosystems) and Bioanalyzer 2100 System (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... Serum IL-6 and CRP levels were measured using in vitro diagnostic methods validated at PPD (Roche Cobas ...