Labshake search
Citations for Roche :
6801 - 6850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 1x EDTA-free protease inhibitor cocktail (Roche), 0.01% digitonin] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1x EDTA-free protease inhibitor cocktail (Roche)] using a dounce homogenizer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, and 1x cOmplete EDTA-free protease inhibitor cocktail [Roche]), and washed again in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, and 1x cOmplete EDTA-free protease inhibitor cocktail [Roche]), and washed again in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were transfected with Tau P301L-V5 encoding full length human tau with P301L mutation and V5 tag (GKPIPNPLLGLDST) and TFEB-GFP at a 2:1 ratio of tau:TFEB (X-tremeGENE 9, Roche). 24 hours later the media was changed and 40 µL of Pff was added to the culture along with 200 nM Bafilomycin (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 µM PMSF and protease inhibitor cocktail (Roche) (80 µl/well) ...
-
bioRxiv - Neuroscience 2023Quote: ... protease inhibitor tablets (Roche, Basel, Switzerland, Cat# 11836170001). Protein concentration was estimated using 4% copper sulfate and bicinchoninic acid (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with Anti-DIG-AP (Roche) at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... protease inhibitor cocktail (Roche, 04693159001), and phosphatase inhibitor (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and phosphatase inhibitor (Roche, 04906837001). Lysates were centrifuged for 10 min at 4,000 g ...
-
bioRxiv - Neuroscience 2023Quote: ... After standard pretreatment in CC1 buffer (Roche), sections were incubated with rabbit anti-HDGF antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... and the KAPA Library Quantification Kit - Illumina/ABI Prism (Roche Sequencing Solutions ...
-
bioRxiv - Microbiology 2023Quote: ... A rat antibody recognizing HA was used (Roche, 11867423001, 1:250) to visualize HA-tagged CA Rab9a ...
-
bioRxiv - Microbiology 2023Quote: ... and the KAPA Library Quantification Kit -Illumina/ABI Prism (Roche Sequencing Solutions ...
-
bioRxiv - Microbiology 2023Quote: ... Respiratory viruses were detected from specimens by real-time PCR and reverse transcription (RT)-PCR assays with LightCycler instruments (Roche, Basel, Switzerland) as previously described (22 ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Biochemistry 2023Quote: ... EASY-pack protease inhibitor cocktail tablets (Roche, Basel) according to instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were incubated with two lysis buffers containing a complete protease inhibitor cocktail (Roche, 11697498001) (Paro Rinse 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and washing in DPBS then lysed in RIPA buffer (Thermo) supplemented with cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche) and 2 U/mL benzonase nuclease (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified and assessed using the Kapa Library Quantification Kit (Kapa Biosystems) and Bioanalyzer 2100 System (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... Serum IL-6 and CRP levels were measured using in vitro diagnostic methods validated at PPD (Roche Cobas ...
-
bioRxiv - Immunology 2023Quote: ... Serum IL-6 and CRP levels were measured using in vitro diagnostic methods validated at PPD (Roche Cobas; Roche Diagnostics, Indianapolis, IN).
-
bioRxiv - Immunology 2023Quote: ... Lungs were perfused with sterile PBS and digested for 1 hour with 625µg/mL collagenase D (Roche 11088875103) and 75U/mL DNase I (Sigma D4527) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... In situ hybridizations were done according to a standard protocol (DIG mix, DIG antibody and BM purple were purchased from ROCHE). Photographs were taken on a Leica M205FA stereomicroscope with a Leica DFC450 digital camera (Wetzlar ...
-
Legionella relative abundance in shower hose biofilms is associated with specific microbiome membersbioRxiv - Microbiology 2023Quote: ... Two – step PCR protocol was used to prepare the sequencing library: a first amplification (target PCR) was carried out with 1X KAPA HiFi HotStart DNA polymerase (Roche), 0.3 µM of each 16S primer and 5 µL of 0.1 to 10 ng of template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... under thermocycler PCR system (LightCyler 96, Roche, Germany). The PCR program was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was generated using Transcriptor First-strand cDNA synthesis kit (Roche) and ProtoScript II first strand cDNA synthesis kit (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis was performed using the Transcriptor first-strand cDNA synthesis kit (Roche) following the manufacturer’s protocol and a primer complimentary to the 3’UTR (Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... and 50 μg/ml Liberase (#5401119001, Roche) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: Viral RNA was extracted from 100 µL of tissue or nasal wash samples using MagNA Pure 24 Total NA Isolation Kit on the MagNA Pure 24 system (Roche) and eluted with 50 µL of water ...
-
bioRxiv - Neuroscience 2023Quote: ... half hemispheres were digested in a 0.4 mg/ml collagenase D solution (Roche Diagnostics, Germany) in phenol-free RPMI media supplemented with 10 mM HEPES and 5% FBS for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... T7 RNA polymerase (Roche, #10881775001) and RNase OUT (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: A DIG-labeled antisense probe against goosecoid (gsc) was generated by in vitro transcription from a linearized plasmid using 10x Transcription buffer (Roche, #11465384001), 10x DIG RNA labelling mix (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-DIG antibody (Roche, #11093274910) was added in a dilution of 1:2.000 and embryos incubated overnight at 4°C on a nutator ...
-
bioRxiv - Cell Biology 2023Quote: ... 10x DIG RNA labelling mix (Roche, #11277073910), T7 RNA polymerase (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... Barcoding PCR was done using KAPA HiFi PCR Kit (Roche) in a final volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a LightCycler® 480 instrument (Roche). Primers for Myc and Actin were as described previously 9.
-
bioRxiv - Neuroscience 2023Quote: ... and 1x protease inhibitor cocktail (cOmplete; Roche, 04693159001) for protein analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were prepared using the Kapa mRNA Hyper Prep kit (KAPA Biosystems, Wilmington, MA) (skin samples ...
-
bioRxiv - Genomics 2023Quote: ... and X-tremeGene 9 (48 μL; Roche), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 12–17µL of resulting libraries were amplified using the NEBNext Illumina primers (that came with the multiplex oligos) and the KAPA Library Amplification Kit (KK2611, Roche Diagnostics) in two separate PCR reactions with 15-17 cycles ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by library preparation (KAPA HyperPlus, Roche), sequencing on a NovaSeq (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library preparation was performed using the KAPA HyperPlus Library Preparation Kit (KAPA Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cOmplete EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl) supplemented with complete protease inhibitor cocktail tablets (Roche #04693159001) and 10 mg lysozyme for GST fusion proteins or in maltose column buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... and pellets resuspended in lysis buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.5 mM TCEP, 1X Roche cOmplete protease inhibitors ...
-
bioRxiv - Cell Biology 2023Quote: ... with SeqCap (Roche) or Illumina TruSeq (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... The gDNA libraries were prepared using the KAPA Hyper Prep Kit (Roche) with SeqCap (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µl RNA eluate was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... before application of Anti-His6-Peroxidase (Roche, 1:1000) in 5% (v/w ...