Labshake search
Citations for Roche :
6401 - 6450 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was quantitated by NanoDrop and 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Neuroscience 2022Quote: ... Hippocampi were isolated and stored in 10 volumes of sucrose buffer 1 (320mM sucrose, 1mM NaHCO3, 1mM MgCl2, 0.5mM CaCl2, 1µM PMSF) containing protease inhibitor cocktail (Roche, Mannheim, Germany). Tissues were homogenized for 10 strokes using a motor-driven 2 ml Potter-Elvehjem homogenizer fitted with a Teflon pestle ...
-
bioRxiv - Molecular Biology 2022Quote: ... IMAC lysis buffer (1.5 ml buffer per gram cell pellet) and the complete stock solution (1 tablet Complete EDTA-free (protease inhibitor cocktail, Roche) and 50 μl benzonase nuclease cell resuspension (PSF ...
-
bioRxiv - Genetics 2022Quote: ... Samples were blocked for 30 minutes in a solution of 1% BSA in 2x SSC with 0.1% tween at room temperature and then rhodamine-conjugated anti-digoxigenin (Roche, #11207750910) or FITC-conjugated anti-biotin (AbCam ...
-
bioRxiv - Cell Biology 2022Quote: ... 25mM Tris-HCl pH=7.5, 1% Triton-X, 10mM Na3VO4, 40mM β-glycerophosphate, 10mM NaF and protease cocktail inhibitor from Roche). 1mg of total protein lysate was incubated with 1µg/mL of purified GST or GST-SidI overnight at 4°C in a rotary mixer ...
-
bioRxiv - Genetics 2022Quote: ... APRE-19 were cultured in a 100 mm dish for 24 hours and then lysed with 1×NP40 lysis buffer supplemented with protease inhibitors Coaktails (Roche) and phosphatase inhibitors(Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... the RNA concentration was determined and 1 µg RNA was used for the cDNA synthesis according to the Transcriptor First Strand cDNA Synthesis kit (Roche). The expression of the following genes FTSH7 (AT3G47060) ...
-
bioRxiv - Cell Biology 2022Quote: 2 μL of FLAG or IgG pull down and of a 1:10 dilution of the INPUT were used for amplification using qPCRBIO SyGreen Mix (PCR Biosystem) in a LightCycler96 (Roche) instrument ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were pelleted by centrifugation and resuspended in sonication buffer (50 mM Tris-HCl pH 8, 1% SDS, 10 mM EDTA, 1x cOmplete ULTRA Tablet (Roche)) and sonicated using a Bioruptor sonicator (Diagenode ...
-
bioRxiv - Molecular Biology 2020Quote: ... the USER digestion product was directly performed index PCR with 1 x KAPA HiFi HotStart Uracil+ ReadyMix (Kapa Biosystems, Cat.No.KK2801). Protocol of Strand Test 3 was almost same as Strand Test 2 ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were washed three times with ice cold PBS and then lysed in 300 μL of 1% SDS lysis buffer with protease inhibitor cocktail (Roche). Lysates were sonicated with a Diagenode Bioruptor Plus with the following settings ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 mM EGTA, 1% Triton X-100, 0.1% SDS, 0.1% Na-Deoxycholate, 140 mM NaCl, 1x Roche cOmplete protease inhibitors). Per IP 30 μl of Protein G Dynabeads (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: MtDNA copy number was analyzed in duplicate by quantitative real-time PCR using 2 μl of 1/400-diluted SacI-treated total DNA in a 10 μl reaction containing 0.2 μM forward and reverse primers and 1× KAPA SYBR FAST qPCR Master Mix for LightCycler 480 (KAPA Biosystems) in a LightCycler 96 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... the transfected cells were lysed in 800 ul PBS with 1% Triton and protease inhibitor (Roche cOmplete EDTA-free tablets), and cleared of debris by spinning in a table-top centrifuge (Eppendorf 5424R ...
-
bioRxiv - Cell Biology 2020Quote: Trichonympha and Teranympha cells were extracted from the hindgut of termites in 10 mM K-PIPES in the presence of cOmplete protease inhibitor cocktail (1:1000; Roche) as described (Guichard et al ...
-
bioRxiv - Biochemistry 2020Quote: ... His – tagged SARS-CoV2 S trimers were purified using a two-step purification protocol by 1 mL or 5mL cOmplete His-tag columns (Roche). Proteins were further purified by size-exclusion chromatography using a HiLoad Superdex 200 16/600column (GE Healthcare).
-
bioRxiv - Pathology 2021Quote: ... The sections were incubated for 1 to 24 hr in the dark at room temperature with development solution (NBT/BCIP substrate, Roche)
-
bioRxiv - Genetics 2021Quote: ... Probes were generated using primers listed in Supplementary Table 1 from the G135P65476A4 BAC as described in [8] and were labeled using the DIG-Nick Translation Mix (Roche) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pelleted nuclei were resuspended in 1 ml ice cold shearing buffer (10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-Deoxycholate, 0.1% SDS, 1x Roche cOmplete protease inhibitors). Buffer compositions for LB1 ...
-
bioRxiv - Microbiology 2020Quote: ... 24 hours post infection cells lysed using NP-40 buffer (50 mM Tris, 150 mM NaCl, 1% Nonidet P-40, and Complete Mini protease inhibitor cocktail [Roche]). Insoluble material were removed by centrifugation ...
-
bioRxiv - Biochemistry 2021Quote: ... two volumes of RIPA buffer supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Science) was added to one volume of packed worms ...
-
bioRxiv - Genetics 2021Quote: ... cells were collected in lysis buffer (TBS + 1% Triton X-100) containing protease inhibitors (Complete Mini EDTA-Free, Roche 04693159001), briefly sonicated ...
-
bioRxiv - Immunology 2020Quote: Cell lysates from flow-sorted bone marrow osteoclast progenitors grown in presence of M-CSF and RANKL over time were harvested in 1% NP40 lysis buffer containing 1X cOmplete Protease Inhibitor cocktail (Roche). Samples were separated by SDS-PAGE and transferred to nitrocellulose membrane ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with BaseMuncher nuclease (Expedion; 1 ml per 40 ml cell suspension) and Complete EDTA-free protease inhibitor mix (Roche). The extract was precleared by centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... the parasites were re-suspended in 1xPBS containing 1 mg/ml soybean trypsin inhibitor and 25x protease inhibitor cocktail (Roche) before the parasites were pelleted and lysed in lysis buffer (4% SDS ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM NaF and 1 mM Na3VO4) in the presence of complete EDTA-free protease inhibitor cocktail (Roche Life Science) for 20 min at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... Sections were then dried and covered in an alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:3000; Roche, Mannheim, Germany) in buffer B1/2.5% goat serum at 4°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: Round spermatids enriched by STA-PUT were lysed with 1% Triton X-100 in PBS supplemented with EDTA-free protease inhibitor cocktail (Roche) by gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein aggregation was evaluated by western blot in total cell extracts prepared in 1% Triton X-100 in PBS containing proteases and phosphatases inhibitors (Roche). Sample quantification was performed with the Pierce BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Cell Biology 2020Quote: Harvested cells were resuspended in lysis buffer (50mM Tris-Cl pH 7.5, 150mM NaCl, 1mM MgCl2, 1% NP40) supplemented with protease inhibitor (Roche 11836170001) and phosphatase inhibitor cocktail (Sigma P5726 ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were washed with cold 1x PBS three times and before scrapping the samples in cold lysis buffer (50 mM Tris pH 7.6, 200 mM NaCl, 1% Triton X-100, 0.5% CHAPS + complete protease inhibitor/Roche Cat# 11836153001). The samples were mechanically disrupted by passing them through a 27.5 syringe five times before sonication on ice (1 sec on ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue was homogenized by probe sonication at 20kHz for 10s in ice-cold TBS buffer (tris-buffered saline, 1% Triton X-100; pH 7.4) containing protease inhibitor (Roche 11697498001) and phosphatase inhibitor (Sigma 4906845001 ...
-
bioRxiv - Neuroscience 2021Quote: ... Both NIB and IP Buffer were supplemented with an EDTA-free cOmplete protease inhibitor cocktail tablet (1 tablet/28 ml; 11873580001, Roche) and RNasin Plus RNase inhibitor (0.2% ...
-
bioRxiv - Genetics 2021Quote: Animals were resuspended in lysis buffer (50 mM Tris/HCl pH 7.4, 100 mM NaCl, 1% v/v SDS, complete protease inhibitor cocktail (Roche Diagnostics)) ...
-
bioRxiv - Immunology 2021Quote: ... 1 µg of total RNA was then reverse-transcribed to cDNA using the iScript cDNA synthesis kit (Biorad; #1708891) (Roche). Diluted cDNAs (1:5 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.1% SDS and 1%Triton X-100 and protease inhibitors cocktail (Mini-Complete EDTA-free; Roche Applied Science, Penzberg, Germany). Lysates were centrifuged (13000g ...
-
bioRxiv - Neuroscience 2021Quote: Dissected brain regions of interest or culture samples were homogenized with TX-soluble buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 1% Triton-X 100) containing protease and phosphatase inhibitors (Roche, USA). The supernatants were collected for soluble fraction after centrifugation (20 ...
-
bioRxiv - Biochemistry 2021Quote: Cells confluent in a 15-cm dish were washed by PBS buffer three times before being lysed on plate with 1 mL ice-cold NP-40 lysis buffer supplemented with protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... minced with a sterile scalpel in a petri-dish containing complete medium (DMEM/10%FBS/2mM L-Glutamine/1x NEAA/1x Sodium Bicarbonate/10mM HEPES/ 1x Pen/Strep) and then incubated with complete medium containing 1 mg/ml Collagenase P (Roche) for 90 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... The cultures were spun down and cell pellets were resuspended in 500 μL of Workman Extract Buffer (40mM HEPEs pH7.4, 250mM NaCl, 0.1% NP40, 10% Glycerol, 1 mM PMSF, Roche proteinase inhibitors). 250 μL of glass beads were added and cells were lysed with Peqlab precellys homogenizator (3×30 sec) ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% Blocking reagent + 20% Goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Roche) in the blocking buffer ...
-
bioRxiv - Immunology 2020Quote: ... Bacterial pellets obtained by centrifugation at 13,500g for 10 min at 4°C were resuspended in 1 ml of PBS containing protease inhibitors (cOmplete Mini, Roche; 1 tablet per 10 ml of PBS following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled probe was generated by purifying a digested (Ncol; 1 cut) pCpG vector DNA using High Pure PCR product Purification Kit (Roche) followed by radiolabeling the probe using Random Prime DNA labeling kit (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were lysed using the same lysis buffer as used for the ribosome profiling experiment with 1× protease inhibitor cocktail (Roche), omitting cycloheximide ...
-
bioRxiv - Immunology 2020Quote: ... was amplified from cDNA using primers mPodoHindFor (GATCAAGCTTATGTGGACCGTGCCAGTGTTG) and mPodoFcRev (GATCGGATCCACTTACCTGTCAGGGTGACTACTGGCAAGCC) and was quantified by SYBR Green 1 mastermix (Roche) qPCR using a PCR thermocycler and normalised to unstimulated control.
-
bioRxiv - Immunology 2020Quote: ... were cut into small pieces with a scalpel and incubated in a Collagenase D (1 mg/ml)/ of DNase I (70 μg/ml) enzymatic cocktail (Roche) in RPMI ...
-
bioRxiv - Immunology 2020Quote: ... mouse thymus was collected and homogenized in 1 ml of cold PBS containing cOmplete protease inhibitor cocktail (Roche, Indianapolis, IN) using a tissue homogenizer (Omni International ...
-
bioRxiv - Immunology 2020Quote: ... The mucosa was stripped and dissociated in GentleMACS tubes in digestion medium (DM; complete medium (RPMI 1640 with PGA/L-glutamine/10% FCS) with 1 mg/mL Collagenase D (Roche), 1 mg/mL soybean Trypsin inhibitor (Sigma) ...