Labshake search
Citations for Roche :
451 - 500 of 5547 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was evaluated using the colorimetric WST-1 assay (Roche Diagnostics). After a 4-h incubation period with WST-1 reagent the absorbance was measured at 450 nm/ 600 nm using a microplate reader (ELISA-Reader Zenyth 200st ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... And then qPCR assays were performed on the LightCycler 480 II (Roche) in 10μL reaction volume containing 6μL of SYBR green Master mix (Fisher Scientific A25918) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured by WST-1 assay following manufacture’s protocol (Roche). The IC50 and CC50 were calculated using a four-parameter logistic regression model from the GraphPad Prism 5 software (GraphPad Software Inc.).
-
bioRxiv - Bioengineering 2021Quote: Primers were designed using the Universal Probe Library Assay Design Center (Roche) and checked for specificity against the Physcomitrella transcriptome in the Phytozome database (Goodstein et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The assay was followed according to the manufacturers protocol (Roche Applied Science).
-
bioRxiv - Cell Biology 2021Quote: ... Te assay was performed according to the instructions of the vendor (Roche). The population doubling time was computed as the ln(2)/slope of the proliferation growth curve using Prism software ...
-
bioRxiv - Biochemistry 2022Quote: ... TUNEL assay was carried out according to manufacturers instructions (Roche Diagnostics, IN). Primary antibodies were visualized with species-specific secondary antibodies conjugated to fluorescent probes ...
-
bioRxiv - Biophysics 2022Quote: ... Cytotoxicity was also performed at matched concentrations using the MTT assay (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Center (Roche). Quantitative PCR was carried out using a LightCycler 96 (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... WST-1 assays to measure cell proliferation rate (Roche Cat. No. 5015944001) were conducted using the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... All qPCR assays were carried out on a LightCycler 480 (Roche Diagnostics) using the LightCycler 480 software version 1.5.1.
-
bioRxiv - Microbiology 2023Quote: ... qPCR assays were performed with a Light Cycler 480 II instrument (Roche), using the Maxima TM SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2023Quote: ... The qPCR assays were done with FastStart Essential DNA Green Master (Roche) with the primers are listed in supplementary methods.
-
bioRxiv - Neuroscience 2024Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Assays were run in triplicate on a Light Cycler 480 instrument (Roche) using the LightCycler 480 SYBR Green Master 2X (Roche) ...
-
bioRxiv - Genetics 2022Quote: ... for 16 hours at 50 V then transferred to a positively charged nylon membrane (Roche) by common squash-blotting technique [26,46] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The membrane was incubated with labeled probe and 250 µg/mL salmon sperm DNA (Roche) at 65°C overnight in Perfecthyb Plus Hybridization Buffer (Millipore) ...
-
bioRxiv - Biochemistry 2020Quote: ... The membranes were then incubated with anti-HA HRP conjugate (3F10, Roche, 1:2000 dilution) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The membranes were then probed with alkaline phosphatase labeled anti-DIG antibody (Roche, Catalog# 11093274910) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... electrophoresed at 100V for 1h and transferred to positively-charged nylon membrane (Roche, Indianapolis, IN) using a Vacuum Blot System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: The RNA was then transferred to positively charged nylon membranes with 0.45μm pores (Roche, 11209299001). RNA was crosslinked to the membrane using a UV Stratalinker 1800 (Stratagene) ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated in blocking buffer containing anti-6xHIS-HRP antibody (Roche Applied Science) at 1:500 dilution ...
-
bioRxiv - Genomics 2021Quote: ... The membrane was hybridised overnight at 42 °C with DIG Easy Hyb (Roche®, 11603558001). The DNA was detected with anti-digoxigenin-Alkaline Phosphatase antibody (Roche® ...
-
bioRxiv - Immunology 2023Quote: ... DNA from 1% agarose gel was capillary transferred to a positively charged nylon membrane (Roche) and cross-linked by UV irradiation by standard procedures ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were probed with rat anti-HA high affinity (clone 3F10, Roche, 1:1,000) and rabbit anti-GAP5085 (a gift from Julian Rayner ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were washed again and visualized by Lumi-Light Plus detection reagent (Roche, Basel, Switzerland).
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was blotted with anti-GFP monoclonal primary antibody (mouse monoclonal, Sigma- Roche #11814460001) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was pre-incubated with 20 mL DIG Easy Hyb™ Granules solution (Roche) at 42 °C for 1 h in a hybridisation oven (Techne™ Hybridisation Oven) ...
-
bioRxiv - Plant Biology 2023Quote: ... The membrane was pre-hybridized and hybridized at 50°C in DIG eazy Hyb (Roche). Two double washing steps were realized using 0.1% SDS ...
-
bioRxiv - Biochemistry 2023Quote: ... the nitrocellulose membrane was incubated with mouse anti-GFP antibodies (1∶1000, Roche Molecular Biochemicals) and rabbit anti-mKate2 antibodies (1:2000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the membrane was incubated with an anti-fluorescein antibody coupled to alkaline phosphatase (Roche; 11426338910), and the chemiluminescent signal detected using CDP-star (Amersham ...
-
bioRxiv - Molecular Biology 2023Quote: ... the membrane was incubated with an anti-fluorescein antibody coupled to alkaline phosphatase (Roche; 11426338910), and the signal was developed using CDP-star (Amersham ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then incubated with the primary antibody (anti-HA, Roche, 11583816001, 1:1000) in TBST + 5% non-fat dry milk overnight at 4 °C followed by incubation with secondary antibodies (Goat anti-Mouse IgG ...
-
bioRxiv - Genetics 2024Quote: ... the membrane was washed and blocked using the DIG Wash and Block Buffer Set (Roche), incubated with Anti-DIG-AP ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with 10 mL of anti-GFP primary antibodies (Roche, Cat.#11814460001) at a concentration of 1 µg/mL in 4 % milk/TBS-T for 1 h ...
-
bioRxiv - Plant Biology 2024Quote: ... transferred to a nitrocellulose membrane and detected with anti-Myc antibodies (1:2000; Roche, 11814150001) and anti-actin antibody (1:2000 ...
-
bioRxiv - Plant Biology 2024Quote: ... The separated proteins were then electrotransferred onto a polyvinylidene fluoride (PVDF) membrane (Roche, Basel, Switzerland). Immunoblotting was conducted using a commercial HRP-conjugated Mouse anti GST-Tag antibody (Abclonal ...
-
bioRxiv - Genomics 2024Quote: ... Depurinated and denatured DNA fragments were blotted onto a positively charged nylon membrane (Roche, Switzerland) overnight by capillary alkaline transfer in 0.4 M NaOH ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were centrifuged and cell killing assessed using the LDH Assay (Roche #11644793001) according to the manufacturers protocol using the SPECTROstar Nano (BMG Labtech).
-
bioRxiv - Genetics 2020Quote: ... Relative qPCR assays were performed using the LightCycler 480 qPCR system from Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2021Quote: ... The proliferation assay was carried out following the manufacturer’s instructions (Roche, Indianapolis, IN) at 24 and 72 hours ...
-
bioRxiv - Cancer Biology 2021Quote: The thermal stability assay was performed in the Real Time Detection system (Roche). Each pMHC complex was diluted in 10 mM Tris-HCl (pH 8.0) ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... cellular proliferation was evaluated using a WST-1 assay (05015944001, Roche, Basel, Switzerland). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR assays were carried out on LightCycler LC480 II (Roche Diagnostics, Germany) using SYBR Green Jumpstart Taq Ready mix (Sigma-Aldrich ...