Labshake search
Citations for Merck :
4051 - 4100 of 5376 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w) ratio using GeneJuice transfecting agent (Sigma-Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lyophilized peptides were resolubilized in 80 % acetone with 1 % TFA and loaded onto an ihouse ZIC-HILIC micro-column containing 30 mg of ZIC-HILIC particles (Merck Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the MSA agar plate was flooded and 500 µg/ml of nalidixic acid (Himedia) and 1 mg/ml of apramycin (Merck). After incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... or Tris-HCl buffered saline (TBS) and incubated at 4°C overnight with primary antibodies (anti-Nr4a2, Abcam, ab41917, 1:500 dilution; anti-GluA1, Merck-Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions corresponding to CVB5 were combined and concentrated to 4.5 mg ml-1 using Amicon Ultra centrifugal filter units with 100 kDa MWCO (Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... in Tris- buffered salione containing 0.1% Tween-20 (v/v) (TBST) fore 60 mins at RT and incubated overnight with primary antibody against REST (1:500) (07-579, Merck), H3K9me2 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... fluorescent visualization of the nonisotopic signals used anti-digoxigenin antibodies conjugated to horseradish peroxidase (anti-digoxigenin-POD; Fab fragment; 1/200; Merck). This was followed by the deposition of biotin tyramide (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: Samples were resuspended in 6 μL 40% (v/v) 1-propanol with vortexing and bath sonication were applied to Silica Gel 60 aluminium-backed HPTLC plates (MERCK) (30 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were mixed at a ratio of 4:1 based on monomer and injected onto a gel-filtration column (Superdex 200, 16/600, Merck) equilibrated in 20 mM HEPES buffer (pH 8.0) ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed using formaldehyde (1% V/V in H2O) for 10 min at RT before supplementation with 125 mM glycine solution (Merck) and agitation for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells harboring GFP-EBV BACmid cells were maintained complete DMEM supplemented with 1 mg/ml puromycin (Sigma-Aldrich/Merck). LCLs (LCL#1 and LCL#89) ...
-
bioRxiv - Microbiology 2023Quote: ... and peak integration was carried out with TraceFinder 4.1 software (Thermo Fischer Scientific) using confirmed retention times for 463 metabolites standardized with a library kit MSMLS-1EA (Merck). Peak smoothening was adjusted to 7 ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequential semithin sections (1 um) were obtained and stained with a solution of 0.5% toluidine blue O (Merck, Darmstadt, Germany) for light microscopy to select cardiac regions comprising the atrioventricular canal and outflow tract ...
-
bioRxiv - Microbiology 2024Quote: ... the amiloride-sensitive component (amilmax) was determined by adding 10 µM amiloride to the apical compartment or ouabain (1 mM, # O3125, Merck) to the basolateral chamber to calculate the maximal ouabain-sensitive Na,K-ATPase activity (ouabmax).
-
bioRxiv - Microbiology 2023Quote: ... The phosphorylated histidine was detected by Western blotting by then incubating the membrane for 60 min with 1:1.000 anti-N1-phosphohistidine antibody (Merck Millipore) in TBS-T followed by a washing step for 30 min with TBS-T and a final 60 min incubation with with 1:10.000 horseradish peroxide-conjugated anti-rabbit IgG (Promega ...
-
bioRxiv - Systems Biology 2023Quote: ... UK), eosin Y 1% alcoholic and xylene (CellPath, UK), periodic-acid (TCS Biosciences Ltd, UK) and Schiff’s reagent (Merck, Germany). Description of the IF and IHC antibodies used can be found in the Supporting Information.
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Biochemistry 2022Quote: ... lysates were incubated with anti-HA agarose beads (20 μl of beads per 1 mg of proteins) (Merck, Darmstadt, Germany) for 2 h ...
-
bioRxiv - Immunology 2022Quote: Decidual cells were isolated as described above and incubated in the presence of fluorescence-labeled latex beads (50 beads per cell; latex beads, 1 µm, carboxylate-modified polystyrene, fluorescent yellow-green, Merck) for 2 hours at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were blocked for 30 min in 0.3 % Triton / 10 % normal goat serum / TBS followed by overnight primary antibody incubation (1:1000; rb TH; Merck Millipore) at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were washed and incubated overnight at 4°C with anti-Digoxigenin-AP antibody (45-11093274910 Merck-SIGMA, 1:1000). Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Genetics 2022Quote: ... Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001, Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... individuals were placed in 0.008% alizarin red (alizarin red S monohydrate, Waldeck Chemie, Münster, Germany) and 1% potassium hydroxide (EMSURE, Merck, Darmstadt, Germany) for 24 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL of filtered protein extract was mixed with 40μL of anti-FLAG M2 magnetic beads (Merck, formerly Sigma-Aldrich) (equilibrated in GTEN + 0.1 % Tween-20 prior to use ...
-
bioRxiv - Microbiology 2023Quote: ... Clarification was then performed by centrifugation for 1 hour at 12,000g and 4°C and vacuum filtration using 45um nylon filter systems (SteriFlip - Merck Millipore). Prior to purification ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktail and 1 μM PARG inhibitor ADP-HPD (Merck). For chromatin fraction ...
-
bioRxiv - Biophysics 2023Quote: ... and was subsequently concentrated to 1 mL using a 100 kDa cut-off Amicon ultra centrifugal filter (Merck Millipore, Germany). The concentrated protein sample was further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Haematoxylin and Eosin staining was performed on few ST muscle sections by incubating the slides at RT for 1 min in hematoxylin solution (Merck). Slides were then washed for 10 min in running tap water before incubating for 1 min in eosin solution (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then acquired on the flow cytometer for ~25 seconds before the addition of 1 μg/mL ionomycin (Merck), and calcium flux was measured for ~1.5 mins.
-
bioRxiv - Cell Biology 2023Quote: ... The pooled fractions were diluted with 2 vols of KPEM buffer to achieve a final concentration of 125 mM KCl and then incubated for 1 hr with 4 mL anti-FLAG monoclonal antibody conjugated resin (M2 agarose, Merck) using rolling ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Microbiology 2023Quote: R47 and R32 wild type strains were inoculated and grown in 6-well plates as described in the RNA extraction section except that 1 ml 0.38 M NaOH (Merck, Germany) was added to the middle two wells to capture HCN in the surrounding ...
-
bioRxiv - Developmental Biology 2022Quote: Organoids were washed with DPBS without calcium and magnesium and added to a 9:1 mixture of Accutase (Merck, A6954) and 10x Trypsin (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were dialyzed against 10 mM HEPES buffer (pH 7.2) containing 50 mM NaCl and 1 mM TCEP and concentrated using Amicon Ultra 100K (Merck Millipore) for electron microscopy analyses ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1:500 dilution of an antibody against the phosphorylated form of H2A histone family member X (γH2Ax) (clone JBW301, Merck) and 1:200 phalloidin coupled to Alexa Fluor 568 ...