Labshake search
Citations for Merck :
3401 - 3450 of 3939 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Freshly isolated cells (4 x 106) were seeded in a pre-prepared gel matrix containing 1 mg/mL rat tail collagen type I (Merck Millipore) in DMEM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was removed with a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 min and the samples were posteriorly collected by centrifuging for 5 minutes at 16000 xg.
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: ... weighed and then dissociated using scissors in 1.2 mL of digestion media containing 1 mg/mL collagenase D (Merck Life Sciences) and 0.1 mg/mL DNase I (Merck Life Sciences ...
-
bioRxiv - Molecular Biology 2021Quote: Xist expression was driven by a TetOn promoter induced by addition of 1 µg/mL of doxycycline (Merck Life Science, D9891). Prior to experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... the solution was incubated at 30 °C for 90 min and then derivatized with 20 µl of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (Merck, USA) at 70 °C for 30 min54 ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were split into either 6 well-plates (300000 cells per well) coated with 1 mg/ml Poly-L- Lysine (PLL, Merck, P9155) for western blotting ...
-
bioRxiv - Cell Biology 2023Quote: Sections were rinsed in 0.1 M PBS three times each for 10 min and then incubated with: i)1:1000 anti-NeuN (A-60; Merck Millipore), 1:300 anti-ΠIII-Tubulin (Tuj1 ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... The purity of the cultures was be routinely assessed by examining the characteristic cell morphologies under phase-contrast microscopy and confirmed by immunostaining with mouse anti-GFAP (1:200; Merck, MAB3402) and mouse anti-S100β (1:400 ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Biochemistry 2023Quote: ... 150,000 to 200,000 HEK293-EBNA cells were plated in 1 mL complete DMEM per well of 12-well cell culture plates (#665180, Greiner bio-one, Merck KGaA). After 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: Astrocytes for long-term neuronal cultures were prepared by dissociating newborn rat cortices with 2.5% trypsin and 1 mg/ml DNase (Merck, cat# 10104159001) and plating the cells in MEM with L-glutamine supplemented with 0.6% glucose ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated in a 10% (v/v) HS PBS solution supplemented with primary mouse anti-β-tubulin III antibody (1:100; Merck) overnight at 4 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated for 1 hour at room temperature with the anti-NOTCH1 primary antibody (Merck Life Sciences, Cat #: SAB4200024) diluted at 1:350 in 1% BSA blocking solution ...
-
bioRxiv - Systems Biology 2023Quote: ... Media was designed based on the Delft composition with a glucose concentration of 10 g/L and the addition of 1 mL/L of Antifoam 204 (Merck, Germany).
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... in 100µl of binding/wash buffer supplemented with protease inhibitor with protease inhibitor cocktail Set I-Calbiochem 1:100 (Cat# 539131, Merck Millipore) and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The purified protein sample was concentrated to 40 mg mL-1 using Amicon Ultra-15 3K MWCO Centrifugal Filter Unit (Merck Millipore) and subsequently diluted 1:4 with MilliQ water (yielding 10 mg mL-1 of protein in 1x crystal buffer (10mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... tissue samples were incubated on ice for 30 min in 1 ml of HPLC-gradient grade methanol (Merck KGaA, Darmstadt, Germany) containing the deuterated internal standards 2-arachidonoylglycerol-d5 (100 ng/ml ...
-
bioRxiv - Genomics 2024Quote: ... 8 x 106 HeLa-Cas9-p65-mNeonGreen cells 10 were transduced with 1 ml lentivirus library and 10 μg/ml polybrene (Merck Millipore). After one day ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.0) containing the cOmpleteTM EDTA-Free protease inhibitor at a 1 x concentration following manufactureŕs instructions (Merck Millipore, Darmstadt, Germany). The buffer volume was proportional to the cell density of the sample ...
-
bioRxiv - Microbiology 2023Quote: ... the tetracycline resistance gene from pACE2 (Geneva Biotech, Genève, CH) and the two MCSs from pACYCDuet™-1 (Novagen, Merck Millipore). Csx23 was inserted into MCS-1 of pRATDuet (NcoI/SalI ...
-
bioRxiv - Immunology 2023Quote: Bovine cytokines and chemokines secreted in the supernatant by cells were measured using the commercial multiplex immunoassay MILLIPLEX MAP Bovine Cytokine/Chemokine Panel 1 (Merck/Sigma). Therefore ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... We then washed them six times for 10 min with 1 % Triton (Triton X-100, X100-100ML, Sigma Aldrich, Merck, Germany) in PBS (thereafter named 1 % PBST ...
-
bioRxiv - Cancer Biology 2023Quote: The Propidium Iodide (PI) working solution was prepared consisting of 4.35 mL 1 g/L sodium citrate dehydrate (Merck, cat# 6448), 0.5 mL 1 mg/mL DNAse-free RNAase A (Sigma ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... Both the supernatant and the resuspended pellet were incubated with 1 U/µL of benzonase (Emprove expert benzonase endonuclease, Merck #101695) at 37 °C for 1 h with gentle shaking to digest non-encapsidated DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 1:100, in-house antibody SCV-1E8 (Morgan et al., 2023)) in conjunction with either anti-NeuN (chicken, 1:3000, Merck, ABN91), anti-Iba1 (rabbit ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Biophysics 2023Quote: ... and the protein of interest was concentrated to 1-2mg/ml in a 50kDa molecular weight cut-off concentrator (Amicon Ultracel, Merck-Millipore). The resulting protein solution was subjected to size exclusion chromatography on a Superose 6 column (Cytiva ...
-
bioRxiv - Plant Biology 2024Quote: ... ACN and then rehydrated with 30 µL of 3.33 µg × mL-1 trypsin (cat-no. T6567 from Sigma-Aldrich/Merck, www.sigmaaldrich.com) in 25 mM ABC ...
-
bioRxiv - Immunology 2022Quote: Cells were lysed by addition of a mild lysis buffer containing 1% octyl-β,D-glucopyranoside (#O9882-500MG, Sigma-Aldrich, Merck), 0.25% sodium deoxycholate (#1065040250 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were placed in fresh buffer PBS-T-milk for 1h (or 1h30 when performing the LTAs western blot in parallel) with the polyclonal rabbit anti-PBP2B antibody (at 1:5000, lab. stock or available at Merck ABS2199), the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and additional wells with 20% biotinylated PLL-g-PEG and FNIII(7-10) were supplemented with 1 µM staurosporine (Merck Millipore) to serve as a positive control for apoptosis ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Bioengineering 2022Quote: ... These oligonucleotides were used to create a phage library representing all oligopeptides using the T7Select 415-1 Cloning Kit (Merck Millipore). Immunoprecipitation of the library was performed in accordance with a previously published protocol (Harhala et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... pre- equilibrated with PBS) and were concentrated to 1 mg/mL using a 10-kDa cutoff Amicon Ultracell Centrifuge Filter Unit (Merck, UFC5010BK), and stored at 4°C in the dark.
-
bioRxiv - Evolutionary Biology 2022Quote: ... the experiments were performed in 96-wells plates containing 100 μL of MM (with 1% agar) supplemented or not with 3mM of H2O2 (Merck S.A) or 0.15mM of menadione (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2022Quote: ... 20S proteasome activity as well as reactive oxygen species production, 300 µl Tris-Buffered Saline (TBS, pH 7.6) and 1% Triton X-100 (Merck, Darmstadt, Germany) were added to a tissue powder aliquot and homogenization was performed using ten consecutive passages through a 24-gauge needle on ice ...
-
bioRxiv - Physiology 2022Quote: ... To generate protein homogenates suitable for western blot analysis, 300 µl Tris-Buffered Saline (TBS, pH 7.6) + 1% Triton X-100 (Merck, Darmstadt, Germany) supplemented with 1x Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast of cell line BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) was grown in 1 litre of YPD (yeast extract (Merck/Sigma-Aldrich cat. no. 70161), peptone (Merck/Sigma-Aldrich cat ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were incubated with a BG4-Flag antibody (1:100 diluted in 0.5% goat serum + PBST, MABE917, Merck, Darmstadt, Germany) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...