Labshake search
Citations for Merck :
201 - 250 of 2276 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... in picric acid (80456, Merck) for 2 hours.
-
bioRxiv - Biochemistry 2024Quote: ... sulfuric acid (H2SO4, Merck, 97%), potassium dichromate (K2Cr2O7 ...
-
bioRxiv - Synthetic Biology 2024Quote: Stearic acid (C18:0, Merck)
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 mM ascorbic acid (Merck), 0.84 uM biotin (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: ... fatty acid-free (Merck, 10775835001) was substituted for regular (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 20μM Retinoic Acid (Merck). At day 6 ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 μl of cell suspension was collected and mixed with 200 μl of ice-cold HBSS containing 5% fatty acid-free bovine serum albumin (BSA, Merck Millipore, 126575-10GM). To quench the fluorescence of non-internalized NBD-phospholipids ...
-
bioRxiv - Genetics 2022Quote: ... 5 µg SA8 was dissolved in 10 µL 10 mM hydrochloric acid and digested with 20 ng/µL pepsin (Merck, cat. No. 10108057001) at 37 °C for 6 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Whole cell extracts (500 μg per IP) were immunoprecipitated for 1h using a PHGDH-specific antibody (Merck Sigma, HPA021241) complexed with Dynabeads Protein A (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... Total chromatin was pre-cleared for 1h at 4°C with rotation using protein A sepharose beads (P9424, Merck). 3 µg of anti-histone H3 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... was performed at room temp for 1h together with DNA staining by DAPI (1 µg/ml, Merck Life science). Cells were washed an additional 3x and imaged on an LSM880 confocal microscope (Zeiss) ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Microbiology 2021Quote: ... Methyl viologen dichloride hydrate (paraquat, 98% purity) and Isopropil-β-D-1-tiogalactopiranósido (IPTG) were purchased from Merck.
-
bioRxiv - Biochemistry 2024Quote: ... Ultrapure nitric acid was produced in-house from trace analysis grade nitric acid (Merck, Darmstadt, Germany) using a SubPur quartz sub-boiling distillation system (Milestone ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Plant Biology 2022Quote: ... The purity of compounds was checked using 1H NMR or thin layer chromatography (TLC) using pre-coated aluminium-backed plates (silica gel 60 F254, Merck) and compounds were visualised by UV radiation at 254 nm and then using an anisaldehyde spray reagent (1% p-anisaldehyde:2% H2SO4 ...
-
bioRxiv - Cell Biology 2023Quote: ... An aliquot of 40 µL was incubated (1h at 70°C on a heating block) by addition of 20 µL of the trimethylsilylating (TMSi) reagent (chlortrimethylsilane [Merck KGaA ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were permeabilized for 1h in 1X PBS containing 0.3% or 0.15% Triton X-100 and 10% donkey serum (Merck, #S30-100ml). Thereafter ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 1 min 30 seconds at high intensity in a 200 mTorr vacuum and then incubated at room temperature for 1h with 200µL/well of 200 µg/mL Poly-D-Lysine (A-003-E, Merck Millipore) diluted in 0.1M HEPES pH 8.4 (H3784-25G ...
-
bioRxiv - Cell Biology 2024Quote: ... with or without 100 nM AMXT-1501 (kindly provided by Aminex Therapeutics) 1h prior to addition of either unmodified or BODIPY-labeled PAs (Merck) at 37 °C and 5% CO2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Reaction was started by the addition of 10 mM Nα-Benzoyl-L-arginine ethyl ester hydrochloride (BAEE, Merck). After 30 min the reaction was quenched with EDTA (50 mM final concentration) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 100mM ascorbic acid (Merck Millipore). After four washes with TBS containing 0.5% Triton X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... acid fuchsin (C.I.42685, Merck-Millipore), and azofloxine (C.I.18050 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cyclopianozic acid (CPA, Merck-Sigma-Aldrich), a blocker of the sarco/endoplasmic reticulum Ca2+-ATPase pump (SERCA ...
-
bioRxiv - Biochemistry 2020Quote: ... all-trans-retinoic acid from Merck Millipore ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetic acid was purchased from Merck, US ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% (v/v) formic acid (Merck), incubated 15 min in an ultrasonic bath (VWR ...
-
bioRxiv - Pathology 2022Quote: ... acid fuchsin (C.I.42685, Merck-Millipore), and azofloxine (C.I.18050 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... amino-acid standards (Merck, Darmstadt, Germany) were analyzed under the same conditions in order to determine typical retention times.
-
bioRxiv - Synthetic Biology 2021Quote: ... Amino-acid standards (Merck, Darmstadt, Germany) were used to determine specific retention times.
-
bioRxiv - Microbiology 2020Quote: ... n-valeric acid (Merck, Darmstadt, Germany) and n-caproic acid (Carl Roth ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetic acid was purchased from Merck, US ...
-
bioRxiv - Neuroscience 2020Quote: ... Triflic anhydride (trifluoromethanesulfonic acid anhydride, Merck/Sigma and sodium azide in analogy to the synthesis of AHA from Boc-Dab described by(Link et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Ascorbic acid was obtained from Merck Ltd. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Amino acid standards (Merck, Darmstadt, Germany) were analyzed beforehand to determine typical retention times.
-
bioRxiv - Neuroscience 2024Quote: ... and α-linolenic acid (L2376, Merck).
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µM oleic acid (Merck, #O1008), or vehicles (0.05% DMSO and 0.02% ethanol) ...
-
bioRxiv - Neuroscience 2023Quote: ... Flufenamic acid (FFA, Merck-Sigma-Aldrich) was first diluted in 100 mM DMSO and then in Low Ca+Co saline at a concentration of 100 μM ...