Labshake search
Citations for Merck :
51 - 100 of 2276 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM sulphuric acid (H2SO4) (Titrisol, Merck, Germany) in water at 55 °C ...
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Biophysics 2024Quote: ... or Methyl -β - cyclodextrin (MβCD, Merck, C4555) to deplete cholesterol ...
-
bioRxiv - Microbiology 2020Quote: ... Mixed cellulose ester filter discs (Merck Millipore) were placed on the surface of M9 agar plates and coated with the diluted cell suspensions ...
-
bioRxiv - Microbiology 2021Quote: ... Mixed cellulose ester filter discs (Merck Millipore) were placed on the surface of M9 agar plates and coated with the diluted cell suspensions ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Bioengineering 2022Quote: ... which was stopped through acidification with 5 μl of trifluoroacetic acid (Merck). Fifteen μg of each resulting peptide mixture were then desalted on Stage Tip (Rappsilber et.al. ...
-
bioRxiv - Microbiology 2024Quote: ... Nucleic acids were labeled with 3 µM DAPI (Ex/Em: 352/464, Merck, Belgium) for 20 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 μl 0.2 μg/ml 4’,6’-diamidino-2-phenyl-indole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... NHS-ester staining: the gel was placed in a 6 well plate and incubated in 594 NHS-ester (Merck, 08741) diluted at 10 μg/mL in 3 ml PBS for 1 hour and 30 minutes at room temperature on a rocking platform ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Bioengineering 2020Quote: ... the master was first placed in a vacuum desiccator beside a glass petri dish containing a droplet of trichloro(1H,1H,2H,2H-perfluorooctyl)-silane (Merck KGaA, Darmstadt, Germany), which subsequently coated the surface of the master with a hydrophobic layer allowing easy future peeling of the polydimethylsiloxane (PDMS ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting peptides were extracted in 70% ethanol plus 5% formic acid (Merck-Millipore) twice for 20 min with permanent shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Plant Biology 2020Quote: DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
bioRxiv - Biophysics 2022Quote: ... sucrose and methyl-β-cyclodextrin (mβCD) were obtained from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... to which 10 µg/mL of methyl stearate (Merck, Singapore) was added as an internal standard ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 3 cm NGM agar plates containing 5-Fluorouracil (5-FU) (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Microbiology 2020Quote: ... syringe filtration using sterile 0.22μm mixed cellulose ester filters (Merck). Filter sterilized Na-glutamate solution was added to a portion of the chemical extract solution from each soil to give a final concentration of 3mM once diluted in final treatment vials ...
-
bioRxiv - Immunology 2020Quote: ... labeled using either ATTO 488 NHS ester (Merck, Cat: 41698) or Dy-549P1 NHS (Dyomics ...
-
bioRxiv - Microbiology 2024Quote: ... the pan-protein labelling reagent Atto-NHS ester 594 (Merck) was used (10 μg/ml in PBS ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 1h treatment with lysozyme at 37ºC (Merck, 100 mg/ml) and 1h proteinase k at 55 ºC (Promrga ...
-
bioRxiv - Neuroscience 2020Quote: ... reverse: 5’-CCAGGGTGGAGCGGTC-3’) and the KOD Hot Start Mastermix (Merck, Darmstadt, Germany). The plasmids were confirmed by sequencing (Seqlab ...
-
bioRxiv - Biochemistry 2023Quote: ... PAPS (adenosine 3′-phosphate 5′-phosphosulfate, lithium salt hydrate) was purchased from Merck and stored at -80 °C to afford maximal stability.
-
bioRxiv - Microbiology 2021Quote: ... The samples were deproteinized by addition of 10 μL of cold 5-sulphosalicilic acid (SSA, Merck) (300 mg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... air-dried at RT for 30 min and fixed in Methanol:Acetic acid in a 3:1 ratio (Merck) at 4°C overnight ...
-
bioRxiv - Biophysics 2022Quote: ... N-hydroxy-succinimide ester (0.1%w/v, Merck Chemicals GmbH, Germany) was added to the oil solution to functionalize the phantoms with Alexa 488 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Assembly reactions were dialyzed with MF-Millipore cellulose ester membranes (Merck) and transformed into electrocompetent E ...
-
bioRxiv - Cell Biology 2024Quote: Periodic acid-Schiff (PAS) (periodic acid, Merck-Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... Coverslips were coated for 1h with 0.1 mg/ml poly-D-lysine (Merck) and then 3.5h with 0.018 mg/ml laminin (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... cells were incubated for 1h at RT with mouse anti-NP (MAB8257, Merck) or mouse anti-M2 (ab5416 ...
-
bioRxiv - Immunology 2021Quote: ... cells were treated with 66 µM Methyl-β-cyclodextrin (MβCD) (Merck, USA) for 1 hour ...
-
bioRxiv - Plant Biology 2024Quote: ... a standard curve was created using known concentrations of methyl erucate (Merck) (Table S1).
-
bioRxiv - Immunology 2021Quote: ... pH 5 (0.1 M citric acid monohydrate from Sigma and 0.2 M disodium phosphate dihydrate from Merck)) was added to the plate and incubated for 30 minutes in the dark ...
-
bioRxiv - Plant Biology 2023Quote: Exogenous hormone treatments comprised 5 μM 1-napthaleneacetic acid (NAA; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Cell Biology 2023Quote: ... The sections were treated with 0.5% Periodic acid for 5 min and stained in Schiff’s reagent (Merck) for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 400μL were mixed with 200μL of a 3 mg/mL collagen in 0.1% acetic acid solution (rat tail type I; Merck Millipore), followed by the addition of 10μL of 1 M NaOH ...