Labshake search
Citations for Merck :
151 - 200 of 2276 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Immunology 2023Quote: ... amino acids (10 mM glutamine, asparagine or aspartic acid – all from Merck), or D-glucose (50 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Brilliant Crocein/Acid Fuchsin (Brilliant Crocein R, Chroma, and Acid Fuchsin, Merck), 5% Phosphotungstic acid PTA (Chroma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Formic acid Ammonium formate and Perchloric acid were also purchased from Merck. Sodium dihydrogen phosphate and di-Sodium hydrogen phosphate were used to prepare the buffer for the enzymatic assay.
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Microbiology 2022Quote: ... citric acid (Merck, USA), lactic acid ...
-
bioRxiv - Biochemistry 2021Quote: ... Hydrochloric acid(Merck, India), Sodium dodecyl sulphate(Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... Acetic acid(Merck, India), Methanol(Merck,India),-20°C Refrigerator ...
-
bioRxiv - Genomics 2021Quote: ... propionic acid (Merck, 8.00605.0500) (3 mL/L ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5M acetic acid (Merck) was added to reach 500 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... oleic acid (W281506, Merck), linoleic acid (436305 ...
-
bioRxiv - Cancer Biology 2024Quote: ... periodic acid (Merck, 100524) was applied for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... and naphthylphthalamic acid (Merck) were supplemented at concentrations indicated in the corresponding figures from 103 concentrated stocks dissolved in dimethylsulfoxide (Acros) ...
-
bioRxiv - Neuroscience 2024Quote: ... linoleic acid (436305, Merck) and α-linolenic acid (L2376 ...
-
bioRxiv - Bioengineering 2023Quote: ... tannic acid (403040, Merck); Iron chloride tetrahydrate (380024 ...
-
bioRxiv - Bioengineering 2023Quote: ... citric acid (Calbiochem, Merck), acetic acid (EMSURE ...
-
bioRxiv - Bioengineering 2023Quote: ... acetic acid (EMSURE, Merck), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... and pantothenic acid (Merck). All incubations were carried out at 30°C.
-
bioRxiv - Genetics 2024Quote: ... tauroursodeoxycholic acid (TUDCA, Merck) or carbamazepine (CBZ ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Biochemistry 2022Quote: ... Reversible blockage of cysteines was performed with S-methyl methanethiosulfonate (MMTS, Merck, Sigma-Aldrich, 64306-1ML) at 4 mM for 30 min at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... followed by 1 hour incubation with 2 mM methyl-β-cyclodextrin (MβCD) (Sigma-Aldrich/Merck, #C4555).
-
bioRxiv - Biochemistry 2024Quote: ... HPLC-grade trichloroacetic acid (TCA) and difluoroacetic acid (DFA) were purchased from Merck and Sigma-Aldrich (Munich ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein transfer was then visualized using 0.1 % Ponceau S solution (w/v) in 5% acetic acid (Merck Life Sciences, Cat #: P7170-1L) and imaged ...
-
bioRxiv - Microbiology 2020Quote: ... and finally through a 0.22 μm collection filter (Cellulose mixed ester membrane filter; Merck Millipore, USA). The pre-processed samples were then kept in 2 ml microcentrifuge tubes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by filtration through a MF-Millipore 8 µm sterile mixed cellulose ester (MCE) membrane (Merck Millipore Ltd. ...
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-phosphorylated (Ser897)-N-methyl-D-aspartate receptor (anti phosphoNMDAR cat.#ABN99, Merck Millipore, Burlington, MA, USA), anti-total-calcium/calmodulin-dependent protein kinase II (anti-tCaMK ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 % deoxycholic acid (Merck) in 50 mM Tris pH 8.0 ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...