Labshake search
Citations for Merck :
101 - 150 of 2276 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... The mixture of labelled bile acids ([2,2,4,4-d4] cholic acid and [2,2,4,4-d4] lithocholic acid) obtained from Merck KGaA was dissolved at a final concentration of 100 μM (for each ...
-
bioRxiv - Neuroscience 2024Quote: ... Fatty acids used were palmitic acid (W283215, Merck), stearic acid (10002390 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4.7 μg/mL linoleic acid-oleic acid (Merck), 100 nM dexamethasone (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... gels were incubated in 1 ml of 594 NHS-ester (Merck: 08741) diluted at 10 μg/mL in PBS for 1 hour and 30 minutes at room temperature on a shaker ...
-
bioRxiv - Cell Biology 2023Quote: ... Atto 594 NHS-ester was used for bulk proteome labelling (Merck 08741). Images were acquired on a Leica TCS SP8 microscope ...
-
bioRxiv - Microbiology 2024Quote: ... Gels were subsequently incubated in stains (NHS ester, Merck and BODIPY, Thermofisher) for 1 hr at RT shaking at 125-150 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... gels were incubated in 1 ml of 594 NHS-ester (Merck: 08741) diluted at 10 μg/ml in PBS for 1 h and 30 min at room temperature on a shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... Atto 594 NHS-ester was used for bulk proteome labelling (Merck 08741). Images were acquired on Zeiss Elyra PS.1-LSM780 and CD7-LSM900 and Airyscan confocal microscopes ...
-
bioRxiv - Systems Biology 2020Quote: ... The resultant pellets were resuspended in 3% acetonitrile + 0.1% trifluoroacetic acid and peptide quantification performed using the Direct Detect system (Merck Millipore). Protein samples were normalized then vacuum concentrated in preparation for mass spectrometry.
-
bioRxiv - Molecular Biology 2020Quote: ... and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v) (Merck, Roth) in a developing chamber (CAMAG ...
-
bioRxiv - Immunology 2022Quote: ... The cell suspensions were supplemented with 0,25% methyl cellulose (cat. #M7027, Merck KGaA), and with either BMMCs in RPMI medium (with 20 ng/ml rm IL-3 and 20 ng/ml rm SCF ...
-
bioRxiv - Neuroscience 2024Quote: ... 1-methyl-D-tryptophan (1-DMT; 1-LMT enantiomer, both Merck Life Sciences) for exploration of a possible tryptophan mechanism of immunosuppression ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... oleic acid and linoleic acid were obtained from Merck, all of them with a purity higher than 97%.
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the NKR-P1 has been fluorescently labeled with Atto 488 NHS-ester (Merck) at pH 6.5 ...
-
bioRxiv - Microbiology 2024Quote: ... The gels were incubated with 8 µg/ml Atto 594 NHS ester (Merck), 10 µg/ml Hoechst 33342 (Molecular Probes ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated for 1h in base assay medium (D5030, Sigma Aldrich, Merck, Darmstadt, Germany) supplemented with 2 mM glutamine ...
-
bioRxiv - Immunology 2023Quote: ... MDMs were also pre-treated for 1h with a TLR3/dsRNA complex inhibitor (Merck Millipore) 5 µM final concentration ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Genomics 2021Quote: ... and gentisic acid (2,5-dihydroxybenzoic acid; Merck, Product Number: 841745) was performed in AT minimal medium (86 ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested peptides were acidified by the addition of 5% (v/v) LC-MS grade Formid Acid (FA) (Merck, 5.33002.0050) and purified on C18 columns (Stagetips ...
-
bioRxiv - Bioengineering 2021Quote: BCP and BG samples dehydrated and embedded in poly-methyl-methacrylate resin (Merck KGaA). Sections performed with Leica SP1600 microtome (Wetzlar ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Carbamate (aldicarb) and organophosphates (paraoxon-ethyl, paraoxon-methyl and DFP) were acquired from Merck and dissolved in 70% ethanol and 100% DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... Trimethylsilyl methyl glycosides were obtained by derivatization with the reagent Sylon™ HTP (Merck) after methanolysis of the polysaccharide with 3 M HCl in methanol at 85°C for 16 h (69) ...
-
bioRxiv - Neuroscience 2024Quote: ... and derivatizing with twice the volume of N-methyl-N-trimethylsilyltrifluoroacetamid (MSTFA) (Merck, Germany) to yield trimethylsilylated analytes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The final clarification was achieved in Methyl Salicylate (M6752, MERCK Sigma Aldrich, MA, USA), which also served as both a storage and mounting medium.
-
bioRxiv - Microbiology 2020Quote: ... Formic acid (Merck) was added to end the reaction (5% v/v ...
-
bioRxiv - Immunology 2023Quote: ... with Ehrlich’s reagent (Sigma)/perchloric acid (Merck) and absorbance was measured at 557 nm ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trichloroacetic acid(Merck), Fetal Bovine Serum (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Microbiology 2020Quote: ... water samples were filtered through 0.45 µm mixed cellulose ester filters (Merck, Darmstadt, Germany) to concentrate spores ...
-
bioRxiv - Immunology 2020Quote: ... that had been fluorophore labeled with either ATTO 488 NHS ester (Merck, Cat: 41698) or Dy-549P1 (Dyomics ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... colonies from MDA-MB-468 cells were fixed by replacing the medium with a solution of 3% trichloroacetic acid in water (Merck, #T6399-500G), rinsed twice with water ...
-
bioRxiv - Microbiology 2021Quote: ... with prior 1h incubation of the biotinylated oligonucleotide with the anti-G4 antibody BG4 (Merck Millipore).
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Biophysics 2024Quote: Glass coverslips (Paul Marienfeld GmbH, 24 x 50 mm, 170 ± 5 μm) were overnight incubated in 100 mM Sulphuric acid (Merck). Afterwards the coverslips were rinsed consecutively with Milli-Q water ...
-
bioRxiv - Bioengineering 2020Quote: ... The structures were developed in propylene glycol methyl ether acetate (PGMEA, Merck KGaA, Darmstadt, Germany) for 25 minutes followed by 5 minutes of treatment with isopropyl alcohol (IPA ...
-
bioRxiv - Microbiology 2023Quote: ... supernatants were coated with overlay medium (1.5% methyl cellulose (w/v) (Merck KGaA; Darmstadt, Germany), 1x MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...