Labshake search
Citations for Becton, Dickinson and Company :
1551 - 1600 of 1697 citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... for macrophages and pDC’s were identified by co-staining of PE conjugated mouse anti-human CD123 (BD Biosciences, USA, 1:20, 37°C for 2h) and mouse anti-human HLA-DR antibody (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and the cell suspensions purity was higher than 90% as assessed by fluorescent staining with PhycoErytherin (PE)-anti-human CD14 antibody (BD Biosciences, San Diego, CA, USA) using a Floid Cell Imaging Station (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... IgA and IgM antibodies were quantified in the CVL specimens using the human immunoglobulin cytokine bead array (CBA) flex set assay (BD Biosciences, San Jose, CA, USA). The Ig CBA assay was performed as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The following mouse and human monoclonal antibodies were utilized for virion capture assays: anti-PSGL-1 and anti-mouse IgG (BD Biosciences, Cat# 556053 and 557273) and anti-gp120s (clones 2G12 and PG9 acquired from the NIH ARP ...
-
bioRxiv - Cancer Biology 2023Quote: ... to isolate GFP+ and GFP-populations from primary tumors after DAPI staining for live cells and from mice metastatic organs after labeling with human CD298-PE (BD, Cat#749741, clone P-3E10) and DAPI for human melanoma and live cells ...
-
bioRxiv - Immunology 2024Quote: ... the cells were washed twice with PBS as described above and the cell pellet was resuspended into 25 µl of FACS buffer (1% FBS in PBS) containing human FC block (BD Bioscience, # 564219; 1:200 dilution) and either 200 nM MLi-2 (synthesised by Natalia Shpiro ...
-
bioRxiv - Cancer Biology 2024Quote: ... human monocyte-derived macrophages were harvested from culture wells using 5 mM Na-EDTA in PBS and incubated for 10 minutes at room temperature with Human Fc Block (BD Biosciences, Franklin Lakes, NJ, USA) to saturate Fc receptors ...
-
bioRxiv - Cell Biology 2020Quote: ... For intracellular staining the cells were incubated for 4 h with the protein transport inhibitor GolgiPlug (BD Biosciences). For fixation and permeabilization of the cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 µg of total protein were separated by SDS-PAGE and probed with antibodies against BUBR1 (BD BioSciences), CDC27 (BD BioSciences) ...
-
bioRxiv - Neuroscience 2020Quote: H4 protein extracts were analyzed by western-blotting probing for aSyn (anti-a-synuclein dilution 1:1000; BD Transduction Laboratories™ ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-Myosin7a (MYO7; 1:200; Proteus; RRID:AB_10013626) mouse anti-CTBP2 (aka C-Terminal Binding Protein 2; 1:200; BD Transduction Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: The following primary antibodies were used: mouse anti-CTBP2 (aka C-Terminal Binding Protein 2; 1:200; BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins bound to the column were eluted with 3 ml Elution buffer (BD buffer with 100 mM imidazole) and aliquoted in 300 μl fractions ...
-
bioRxiv - Neuroscience 2022Quote: Antibodies used included: C-terminal binding protein-2 (mouse anti-Ctbp2; BD Transduction Labs, used at 1:200), myosin-VI (rabbit anti-myosin-VI ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins bound to the column were eluted with 3 ml elution buffer (BD buffer with 100 mM imidazole) and aliquoted in 300 μl fractions ...
-
bioRxiv - Biophysics 2020Quote: ... the sorted cell population was analyzed 1 hour after induction of protein expression by flow cytometry (Instrument: BD FACS-Aria SORP cell sorter ...
-
bioRxiv - Pathology 2022Quote: ... with allophycocyanin (APC) against B220 and with peridinin-chlorophyll proteins (PerCP-Cy™ 5.5) against CD45 from BD Pharmingen were diluted at 1/50 in PBS ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins in the lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (BD Biosciences). The phosphorylation of the ERBBs and ERK was detected on the membranes with anti-pERBB1–B4 and anti-ppERK primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% penicillin/streptomycin and 10 mM HEPES (pH 7.4) with 25% high-protein Matrigel (product 354248; BD Biosciences)) ...
-
bioRxiv - Genetics 2022Quote: ... Anti-RPA4 (1:4000-1:8000, sheep serum, home made), Anti-Actin Protein Antibody (1:30,000, mouse) (BD Transduction Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies used included: C terminal binding protein-2 (mouse anti-CtBP2; BD Transduction Labs, used at 1:200), myosin-VIIA (rabbit anti-myosin-VIIA ...
-
bioRxiv - Immunology 2023Quote: ... Cytokines were analysed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen or eBioscience were used for flow cytometry: Phycoerythrin (PE) or peridinin chlorophyll protein -cyanine 5.5 (PerCP-Cy5.5)-conjugated CD3 (BD Biosciences Cat#5 61808 ...
-
bioRxiv - Immunology 2023Quote: Cytokines were analyzed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200) and (2) C-terminal binding protein 2 (mouse anti-CtBP2; BD Biosciences; used at 1:200) with secondary antibodies coupled to Alexa Fluors 647 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Flow analysis of the correlation of protein production levels was carried out on a LSR II (BD Bioscience) equipped with 405 nm ...
-
bioRxiv - Immunology 2023Quote: ... Note these experiments were carried out using early access kits from BD Genomics before the implementation of commercially-available single-cell protein/RNA assays (e.g. Feature Barcoding, 10x Genomics; BD Abseq ...
-
bioRxiv - Immunology 2024Quote: ... and BD GolgiPlug Protein Transport Inhibitor (containing brefeldin A; 1 mg/mL; BD Biosciences, Franklin Lakes, NJ, USA). Following this ...
-
bioRxiv - Biophysics 2024Quote: ... transferred in a V-bottom 96-well plates and co-cultured with K562 cells (ATCC) at 1:1 effector-to-target ratio in the presence of mouse anti-human CD107a Alexa Fluor 647 (BD Bioscience, clone H4A3, 2 uL/well) for 6 hours at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Non-specific antibody staining was inhibited using blocking buffer (male 10% human AB serum, 1% bovine serum albumin, 2 mM EDTA, 25 μg BD Fc Block; 15 min, 4°C) and washed before completing surface stain in staining buffer (PBS supplemented with 1% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were transferred to supported nitrocellulose membrane and probed using Syn101 antibodies against aSyn (BD labs, San Jose, CA). Blots were imaged on using a ChemiDoc MP imager and analyzed using Image Lab (Bio-Rad ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... cells expressing TagRFP-tagged proteins were flow-sorted using a BD Influx cell sorter (BD Bioscience, San Jose, CA). TagRFP emission was triggered by 561 nm laser ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2021Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Prox1 and pErkT202/Y204 proteins were detected non-fluorescently using biotinylated goat anti-rabbit IgG (1: 400, BD Biosciences) followed by avidin-HRP and DAB detection (Vector labs ...
-
bioRxiv - Immunology 2022Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Neuroscience 2024Quote: ... We processed the membrane for protein detection using antibodies against CD63 (1:1000; BD Biosciences, San Jose, California, USA), CD81 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... We stained intracellular proteins using the following antibodies: anti-mouse CD3 BUV737 (1:100, 17A2, BD Biosciences, Cat. 612803) and anti-mouse CD4 Alexa Fluor 700 (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... in flotation for 1 h at room temperature and then overnight at 4°C with the mouse antibody that recognizes protein GM130 (Cat# A-610822, RRID:AB_398141, BD Biosciences), followed by incubation for 2 h at room temperature with Alexa Fluor 546-conjugated goat anti-mouse secondary antibodies (Cat#A-11030 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...