Labshake search
Citations for Lucigen :
351 - 400 of 420 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 250 pmol of Qβ-RNA were treated with 60 U of RNA 5’-polyphosphatase (Epicentre) in 1 x polyphosphatase reaction buffer at 37 °C for 70 min ...
-
bioRxiv - Genetics 2023Quote: ... 400 ng of DNA was incubated with 5 U Plasmid-Safe ATP-Dependent DNase (Lucigen), 25 mM ATP solution ...
-
bioRxiv - Genetics 2021Quote: ... and four CS (line 403 subclones 1, S7, S8, and S9) iPSC lines was extracted using quick extract DNA extraction solution (Epicentre #QE09050), amplified by PCR ...
-
bioRxiv - Bioengineering 2020Quote: ... Genomic DNA was extracted from wild-type and GLUT1-null Caco-2 cells with QuickExtract DNA Extraction Solution (Lucigen, SS000035-D2) and regions of interest were PCR amplified with the designed primers and Taq polymerase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were washed once with DPBS and genomic DNA (gDNA) was extracted with 50 µL/well of Quick-Extract solution (Lucigen, QE09050). Lysates were pipetted up and down thoroughly ...
-
bioRxiv - Genomics 2022Quote: ... and diluted at 1:100 ratio into 250 ml LB supplemented with kanamycin (50 μg/mL) and 1x copy number induction solution (Lucigen, CCIS125). Payload DNA was isolated from E ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the plates was used for quick genomic DNA isolation for each of the colonies using QuickExtract DNA extraction solution (Lucigen # QE09050). 5μl of this lysate was used to set up a quick genomic PCR screening for IL-1β knockout clones using checking primers ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA for CRISPR/Cas9 genotyping was isolated from cell lines and organoids by using Quick Extract DNA Extraction Solution (Lucigen, #QE09050). For organoids ...
-
bioRxiv - Plant Biology 2023Quote: ... Thirty thousand cells of each clone were added to 100 μL of Quick Extract™ DNA Extraction Solution (Lucigen, Wisconsin, USA). DNA was extracted by heat treatment (65°C for 6 min and 98°C for 2 min) ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA from CD34+ cells or Bone Marrow of transplanted mice was extracted with the QuickExtract™ DNA Extraction Solution (Lucigen). For CD33 and each off-target site ...
-
bioRxiv - Genomics 2023Quote: ... Each aliquot of 4 μg was depleted from ribosomal RNA with 10 μl of rRNA removal solution from the Ribo-Zero kit (RiboZero kit, catalog num. MRZH11124, Epicentre-Illlumina), strictly following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were counted and 1e6 cells for each sample were collected and washed with PBS before RNA were extracted by QuickExtract RNA Extraction Solution (Lucigen, QER090150). SuperScript IV VILO Master Mix (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... A piece of embryonic tail was taken from each embryo and DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen) according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from 2.5×105 Neuro2A cells with 250 μL of QuickExtract DNA Extraction Solution (Lucigen, Middleton, WI, USA) or from 30 mg of mouse liver using a EZ-10 Spin Column Animal Genomic DNA Miniprep Kit (Bio Basic ...
-
bioRxiv - Cell Biology 2024Quote: The electroporated progenitors were subjected to adipogenic differentiation for 8 days and the genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen QE09050). PCR reactions were conducted with 100 ng of genomic DNA and following primer pairs spanning the sgRNA target site in KAPA HiFi HotStart ReadyMix (Roche KK2602 ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 μL of T4 polynucleotide kinase (5 U/μL) plus 2.5 μL 10X Reaction Buffer (Lucigen) were added to the initial 20-μL nucleic acids solution ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: Synthetic RNA substrate H4 (34) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre, RJ411250), followed by pooling and purification of ligated footprints using an Oligo Clean and Concentrator column (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Genomics 2024Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA was extracted after 48-72 hrs incubation using 50 µL Quick Extract™ DNA Extraction Solution (Lucigen, Middleton, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Neuroscience 2020Quote: Genome DNA of transfected N2a cells or tissue cells were extracted by QuickExtract™ DNA Extraction Solution 1.0 (QE09050, Lucigen, Middleton, WI) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Clones with the best response to TMP were expanded and lysed for gDNA extraction and purification using the QuickExtract DNA extraction solution (Lucigen, Middleton, WI). Genomic ecDHFR was amplified (forward ...
-
bioRxiv - Molecular Biology 2020Quote: ... The swabs were each placed in 1.5 mL Eppendorf tube containing 200 ul of QuickExtract DNA Extraction Solution (QE buffer, Lucigen LLC, Madison, WI). Each tube was vortexed and stored until extraction.
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA from edited and unedited HSPC samples was harvested 48h post-editing using QuickExtract DNA Extraction Solution according to manufacturer’s recommendations (Lucigen Corp., Teddington, UK) and diluted to 4.55 ng/uL in IDTE pH 8.0 (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was discarded and the pellet resuspended in 300 μl of lysis solution and 1 μl of RNase A from the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, US). The kit protocol was followed ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR screening of the colonies was performed using genotyping oligos listed in Supplementary Table 1 using Quick Extract DNA Extraction Solution (Lucigen Catalog Number: QE09050) according to manufacturer’s protocol in a PCR machine and DreamTaq Green Polymerase (Thermo Fisher Scientific Catalog Number ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Genomics 2021Quote: ... Single cells were clonally expanded and genomic DNA was extracted from half the clonal population using QuickExtract™DNA Extraction Solution (Epicentre cat # QE09050) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... After the wash step cells were incubated in 200 ul PBS with 350u/ul of lysozyme solution (Epicentre ready-lyse, Epicentre Madison WI USA) for 30 minutes at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were centrifuged and resuspended in TE buffer and incubated overnight at 37°C after addition of the Ready-Lyse lysozyme solution (Lucigen, Middleton, WI, USA). gDNA extraction (Lucigen ...
-
bioRxiv - Developmental Biology 2023Quote: The genomic DNA of individual control or Dll-KO embryos (sorted manually based on injection marker or on reporter expression) were extracted with 20 μl of Quick Extract ™ DNA Extraction Solution (Lucigen, Cat# QE09050) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... After the wash step cells were incubated in 200 ul PBS with 350u/ul of lysozyme solution (Epicentre ready-lyse, Epicentre Madison WI USA) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... filled with 1 ml LB supplemented with 25 μg/ml chloramphenicol and 2 µl/ml CopyControl fosmid autoinduction solution (Epicentre Biotechnologies, Cat. No. AIS107F). The plates were grown at 30 °C shaking at 700 RPM for 16 h covered by an AeraSeal gas-permeable sheet (EXCEL Scientific Cat ...
-
bioRxiv - Microbiology 2022Quote: ... Swabs were incubated for one hour at 37°C with shaking in 300μL yeast cell lysis solution (from Lucigen MasterPure Yeast DNA Purification kit) and 10,000 units of ReadyLyse Lysozyme solution (Lucigen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...