Labshake search
Citations for Lucigen :
651 - 700 of 760 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... C-circle and G-circles assays were performed as before except that NxGen® phi29 DNA Polymerase (Lucigen Corp.) were used for rolling circle amplifications [25].
-
bioRxiv - Evolutionary Biology 2021Quote: ... a (modified) CTAB protocol or a rapid desalting method (MasterPure™ Complete DNA and RNA Purification Kit; Lucigen Corporation).
-
bioRxiv - Genomics 2020Quote: ... an aliquot of 25 uL was reserved from each sample for extraction of DNA with MasterPure™ kit (Epicentre) and bacterial cell count was measured using qPCR (TaqMan™) ...
-
bioRxiv - Genomics 2020Quote: ... gDNA for the rest of the strains was extracted using the Masterpure Complete DNA and RNA purification kit (Lucigen) using the protocol for tissue samples ...
-
bioRxiv - Genomics 2021Quote: ... About 30 ug of total gDNA was recovered from using MasterPure™ Complete DNA and RNA Purification kit (Lucigen), and 0.5ug-1ug gDNA was checked on a 1% agarose gel for integrity and quality ...
-
bioRxiv - Plant Biology 2021Quote: ... a PCR-free library was prepared with the NxSeq® AmpFREE Low DNA Library Kit (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... waltii isolates as well as the generated hybrids were extracted using a modified MasterPure Yeast DNA purification protocol (Lucigen).
-
bioRxiv - Microbiology 2020Quote: ... HBV cccDNA was quantified from total DNA following digestion for 45 min at 37°C with T5 exonuclease (Epicentre) to remove rcDNA followed by 30 min heat inactivation ...
-
bioRxiv - Cancer Biology 2021Quote: ... These primers were used to amplify cell pools after DNA extraction using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050). Amplified reads were sequenced on either an Illumina MiSeq or Illumina HiSeq 2500.
-
bioRxiv - Cancer Biology 2022Quote: ... A minimum of 1.2ug of ligated pUSEPR plasmid DNA per sub-pool was electroporated into Endura electrocompetent cells (Lucigen), recovered for one hour at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... A total of 1.2 µg of ligated pUSEBR-CRISPR Library plasmid DNA was then electroporated into Endura electrocompetent cells (Lucigen). Competent cells were recovered for 1 h at 37ºC ...
-
bioRxiv - Microbiology 2020Quote: ... Three μg of purified DNA were treated with 2 μl of Plasmid-Safe ATP-dependent exonuclease (Epicentre, Madison, USA) at 37°C for 30 minutes and then heat-inactivated by a 30-min incubation at 70°C.
-
bioRxiv - Cancer Biology 2020Quote: ... HBV plasmid (positive control) and HBV DNA from inoculum was digested with plasmid-safe DNase (Epicentre, E3101K, Madison, WI). According to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Isolated DNA was used to construct a fosmid library using the CopyControl™ Fosmid Library Production kit (Lucigen Corporation) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... Supernatant were carefully discarded and the isolated hair cells were lysed by 5μl QuickExtract™ DNA Extraction Solution (Lucigen) and incubated in 65°C for 6 min then 98°C 3 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Purified genomic DNA from each individual was used to prepare paired-end libraries (Lucigen Shotgun library preparation, PCR free) and sequenced on an Illumina HiSeq X PE 150 bp platform to 10-20X coverage at the Centre d’ Expertise et de Services ...
-
bioRxiv - Cell Biology 2022Quote: ... Isolated genomic DNA was combined with EconoTaq PLUS GREEN 2X Master Mix (cat# 30033-1; Lucigen, Middleton, WI, USA) and forward and reverse primers (primer information listed in Table S2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... During this process individual embryos were collected at 6 and 24 hpf in QuickExtract™ DNA Extraction Solution (Lucigen) for Indel mutations genotyping using MiSeq sequencing.
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI) and vortexed for 10s ...
-
bioRxiv - Genetics 2021Quote: ... columns and approximately 120–150 ng of DNA was used as template for a T7 in vitro transcription (IVT) reaction (AmpliScribe-T7-Flash transcription kit from Epicentre). In vitro transcribed gRNAs were DNAse-treated using TURBO-DNAse for 20 min at 37 °C and precipitated with sodium acetate/ethanol and resuspended in RNAse and DNAse free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... pre-digested DNA was extracted and further incubated with 20 U plasmid-safe DNase (PS-DNase, Lucigen®, Epicentre, UK) and 1mM ATP at 37 °C for 24 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... pre-digested DNA was extracted and further incubated with 20 U plasmid-safe DNase (PS-DNase, Lucigen®, Epicentre, UK) and 1mM ATP at 37 °C for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... At this stage a small aliquot of cells (75% of the plate) was lysed in 200 μL of QuickExtract DNA Extraction solution (Lucigen) and gDNA was prepared by heating to 65° C for 10 minutes followed by heat inactivation at 95° C for 2 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nematodes were washed individually from each mapping line in approximate equal pellet sizes prior to pooling and genomic DNA extraction using the MasterPure Kit (Epicentre). We sequenced the whole genomes of tu391 and csu60 ...
-
bioRxiv - Biochemistry 2020Quote: ... 124 nt oligonucleotides (IDT) (see Supplementary Table S7) were circularized using with CircLigase™ single stranded (ss) DNA Ligase (Lucigen) according the manufacturers suggestion ...
-
bioRxiv - Neuroscience 2020Quote: DNA from six PVN from each supplemental tactile stimulation group in the repeated room temperature condition and nest temperature condition (total n = 24) was extracted using the Masterpure Complete DNA/RNA Extraction kit (Epicentre) and 300 ng of DNA was used for bisulfite conversion using the Epitect Fast Bisulfite Conversion kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... and aliquots of 100 μL were dispensed into 0.1 mm gapped electroporation cuvettes along with 1 μg of plasmid DNA and 1 μL of Type-One restriction inhibitor (Epicentre). Electroporation was performed with a Bio-Rad Micropulser (Ec3 pulse ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2022Quote: ... electroporated with Rmona658B genomic DNA that had been linearized by digestion with SmaI and ligated into the linear vector pJAZZ (Lucigen). The resulting construct was termed pJAZZ[pRM658B] (Fig ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting air-dried pellets were resuspended in RNase-free water and 3 µg of DNA from each sample was depleted of ribosomal RNA using the Bacteria Ribo-Zero rRNA Removal Kit (Epicentre) and purified using the RNeasy miniprep kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... Clonal populations were genotyped by Sanger sequencing the PCR amplified sgRNA-targeted sites in the gDNA extracted using DNA QuickExtract (Lucigen). Resulting sequences were compared to references and clones containing a frameshift indel or de novo stop codon were selected ...
-
bioRxiv - Genomics 2022Quote: ... Subsequent library preparation was performed with the NxSeq® AmpFREE Low DNA Library Kit (Lucigen®; Cat. no. 14000-1) according to the manufacturer’s instructions with one slight modification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The library prep was performed according to the manufacturer’s instructions for the NxSeq® AmpFREE Low DNA Library Kit from Lucigen® (Cat No ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cell debris was then pelleted and used for gDNA extraction with 10-20 µl QuickExtract™ DNA Extraction Solution (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... After mutagenesis DNA sublibrary pools were digested with appropriate restriction enzymes to remove phagemid template before transformation into SS320 electrocompetent cell (Lucigen) for phage production ...
-
bioRxiv - Microbiology 2020Quote: Genes were amplified by PCR using the appropriate primers and the amplified DNA cloned in pET28b using NheI/XhoI restriction sites or pETite (ExpressoTM T7 cloning and expression system, Lucigen) generating constructs with either N- or C-terminal His6 tags (Supplementary Table 7) ...
-
bioRxiv - Genetics 2020Quote: ... DNA was isolated from tail snips of MyD88 CRISPy TAKO and Mock-treated control offspring using Quick Extract (Lucigen, #QE09050). Primers for MyD88 genotyping are listed in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from harvested cultures using the Masterpure™ Complete DNA and RNA Kit (Lucigen Corporation, Middleton, Wisconsin). RNA was subsequently purified using the Zymo RNA Clean and Concentrator™ Kit (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: Samples were analyzed directly or mixed 1:1 with one of the following buffers: Quick Extract DNA Extraction Solution (Lucigen), Virotype Tissue Lysis Reagent (INDICAL BIOSCIENCE GmbH ...
-
bioRxiv - Genomics 2021Quote: ... 11 μL purified CUT&Tag-DNA was used in the reaction (11 μL DNA, 2 μL 10 μM Tn5mC-ReplO1 oligo, 2 μL 10× Ampligase buffer (Lucigen), 2 μL dNTP mix (2.5mM each ...
-
bioRxiv - Molecular Biology 2020Quote: ... Comparable results to commercial RNA extraction kits have been obtained using a 5-min direct detection preparation method of nasopharyngeal samples following 1:1 dilution with the Quick Extract DNA extraction Solution (Lucigen) (6) ...
-
bioRxiv - Microbiology 2022Quote: RNA from endodontic samples was extracted using the MasterPure Complete DNA and RNA Purification Kit (Epicentre Technologies, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Single clones were expanded and genotyped for the desired knock-in by PCR on genomic DNA extracted with Quickextract solution (Lucigen). Clones showing biallelic knock-ins were expanded and frozen in LN2 at early passages ...
-
bioRxiv - Genomics 2023Quote: ... 200µL of the cell suspension was washed twice in PBS and genomic DNA was extracted with Quickextract solution (Lucigen, QE0905T) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were maintained under regular media exchange until reaching ∼90% confluency when editing was analyzed by extracting genomic DNA using QuickExtract (Lucigen).
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...