Labshake search
Citations for Lucigen :
451 - 500 of 760 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted using the Epicenter Masterpure kit (Epicentre Technologies, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... DNA collection from cultured cells was performed using QuickExtract (Lucigen QE09050).
-
bioRxiv - Developmental Biology 2021Quote: Standard genotyping was performed by DNA extraction with QuickExtract buffer (Lucigen), after ear clipping (pups ...
-
bioRxiv - Cell Biology 2022Quote: The MasterPure™ Complete DNA and RNA Purification kit (Epicentre, MC85200) or the RNeasy kit (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted using the MasterPure kit (Lucigen, cat no MC85200).
-
bioRxiv - Genomics 2021Quote: ... these BAC DNAs were completely digested with ATP-Dependent DNase (Epicentre) to remove the host E ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100,000 iPSCs were taken for DNA extraction using Quick Extract (Lucigen), whereas organoid samples were directly added to Quick Extract (Lucigen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... furfur CBS 14141 were isolated with MasterPure yeast DNA kit (Epicentre) as per manufacturer’s protocol with additional step of homogenizing at 6 m/s for 50 sec (MP Biomedicals) ...
-
bioRxiv - Genetics 2020Quote: ... Genomic DNA (gDNA) was extracted with QuickExtract buffer (Lucigen, Middleton, USA) by adding 30 μL to a well of a 96-well plate and incubating for 5 min ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The synthetic template DNA (IDT) was circularized using CircLigase II (Epicentre), treated with Exonuclease I (NEB ...
-
bioRxiv - Genomics 2021Quote: ... 1.5 μl ATP and 1 μl FastLink DNA ligase (Lucigen Corporation), followed by heat inactivation for 15 min at 70°C ...
-
bioRxiv - Genetics 2020Quote: ... depleted of genomic DNA contamination using Baseline-Zero DNase (Epicentre, #DB0715K), and depleted of rRNA using a Yeast Ribo-Zero Gold rRNA removal kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted with Epicentre Masterpure Kit (Epicentre Catalog number: MC85200). Sample and sequencing library preparation was done by using the Nextera DNA library preparation kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using a MasturePure extraction kit (Lucigen), and 16s rRNA amplicon libraries were prepared with primers 515F and 806R ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was isolated after 72 hours using QuickExtract (Lucigen, USA) and fragmented using the LOTUS™ DNA library kit (IDT ...
-
bioRxiv - Physiology 2022Quote: ... sorted (eGFP+) cells was extracted using QuickExtract DNA Extraction Solution (Lucigen). EnGen Mutation Detection Kit (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... and gDNA was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) for PCR screening of targeting vector integration ...
-
bioRxiv - Cancer Biology 2024Quote: ... and gDNA was extracted by using QuickExtract DNA Extraction solution (Epicentre) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 0.2 µl of Fast-Link DNA Ligase (Lucigen, cat. no. LK6201H), 1.2 mM ATP ...
-
bioRxiv - Bioengineering 2022Quote: ... genomic DNA was extracted 72 hrs after transfection using QuickExtract (Epicentre). For flow cytometry assays ...
-
bioRxiv - Microbiology 2023Quote: ... extractions were performed using the MasterPure yeast DNA purification kit (Epicentre). Genomic libraries ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligated pUSEPR plasmid DNA was electroporated into Endura electrocompetent cells (Lucigen), recovered for one hour at 37⁰C ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA was extracted from frozen slices using QuickExtract buffer (Lucigen). The genomic region containing CRISPR-edits was PCR amplified from genomic DNA template using RedExtract PCR mix (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... genomic DNA was isolated from ear clips using QuickExtract buffer (Lucigen) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... genomic DNA was isolated from ear clips using QuickExtract buffer (Lucigen) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... media aspirated and 30uL of QuickExtract™ DNA Extraction Solution (Lucigen) added to the wells ...
-
bioRxiv - Immunology 2021Quote: ... bisulfite-modified DNA sequencing libraries were generated using the EpiGenome kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Genomics 2020Quote: ... Nucleic acids were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200) according the manufacturer’ instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA was treated with 10U of Plasmid-safe Dnase (Epicentre® Illumina) for 45 minutes at 37°C following thelatest update of the international working group on cccDNAstandardization (Allweisset al. ...
-
bioRxiv - Neuroscience 2021Quote: ... tail samples were lysed in QuickExtract DNA Extra Solution 2.0 (Lucigen, USA) and PCR reactions were carried out with GoTaq DNA polymerase and with the Primers ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from each isolate using QuickExtract (Lucigen, Wisconsin, USA) according to manufacturer’s protocol from the above mentioned 0.1X TSB cultures ...
-
bioRxiv - Plant Biology 2021Quote: ... The genomic DNA was further purified with the MasterPure kit (Lucigen, MC85200) and submitted to sequencing on a HiSeq PE150bp (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The genomic DNA was extracted using the Lucigen (Epicentre; Middleton, WI, USA) Masterpure Gram Positive DNA Purification Kit per manufacturer’s instruction with the following modifications ...
-
bioRxiv - Biophysics 2021Quote: ... coli strain DH5α was isolated using the QuickExtract DNA extraction solution (Lucigen). The coding sequences of the four autoinducer-2 exporter genes were amplified using the Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... bisulfite-modified DNA sequencing libraries were generated using the EpiGenome kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and resuspended in 50 µL QuickExtract DNA extraction solution (LuciGen, Middleton, WI). The suspensions were transferred to 96-well PCR plates and incubated at 65 °C for 20 min and then at 98 °C for 5 min using a thermocycler ...
-
bioRxiv - Developmental Biology 2022Quote: ... and genomic DNA was isolated using a Quick-Extract Buffer (Lucigen GE09050). Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotyping was performed by using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) on a fraction of a clone ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted three days after transfection with QuickExtract (QE) (Lucigen). Cells were washed once with PBS and 50 μL QE was added per well of a 96-well plate ...
-
bioRxiv - Cancer Biology 2023Quote: ... the genomic DNA was treated with Plasmid-Safe ATP-dependent DNase (Lucigen) at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Extraction of template genomic DNA was performed by using QuickExtract (Epicentre QE0905T). 2 μl of genomic DNA extract solution was used to PCR amplify the genomic locus of interest (RFX2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA contamination was depleted using Baseline-Zero DNase (Lucigen/Epicentre, #DB0715K) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: Tissue from resulting animals was lysed using QuickExtract DNA Extraction Solution (Epicentre) to release the genomic DNA ...
-
bioRxiv - Bioengineering 2023Quote: ... Ampligase DNA Ligase and 10X Reaction Buffer were purchased from Lucigen (A3202K). 2X GoTaq G2 Hot Start Colorless Master Mix was purchased from Promega (9IM743) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA contamination was depleted using Baseline-Zero DNase (Lucigen/Epicentre, #DB0715K) according to manufacturer’s instructions ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The resulting ligated DNA was transformed into electrocompetent cells E.coli SS320 (Lucigen) and propagated overnight.
-
bioRxiv - Neuroscience 2023Quote: DNA was extracted from 96-well plates of cells using QuickExtract (Epicentre) by incubation at 65°C for 6 minutes ...
-
bioRxiv - Genomics 2024Quote: ... or the NxSeq® AmpFREE Low DNA Library Kit (Lucigen; # 14000-2). In total ...