Labshake search
Citations for Lucigen :
251 - 300 of 760 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from 154 clinical and environmental samples using the MasterPure™ DNA Purification Kit (Epicentre), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted independently for each specimen using the MasterPure Complete DNA and RNA purification Kit (Epicentre) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from pure colonies using the MasterPure™Yeast DNA Purification Kit (Epicentre, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... the individual clones were expanded and the DNA was isolated using the QuickExtract DNA Extraction Solution (Lucigen). A successful homozygous genomic modification was confirmed by PCR (data not shown ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and genomic DNA was extracted from them using the MasterPure DNA Purification kit (Epicentre, Madison, WI, USA). Genomic DNA from one additional human iPSC (AG25370 ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA from the samples was isolated using MasterPure Complete DNA & RNA Purification Kit (Lucigen, Middleton, WI) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted with the MasterPure™ Complete DNA and RNA Purification Kit (Epicentre, Cat. No.: MC85200). The Qubit 3.0 fluorometer and Nano-300 (Allsheng™ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DNA of 2 mL overnight culture was extracted with the MasterPure™ Yeast DNA Purification Kit (Lucigen) and whole PCR Tag analysis was performed on population level to test the general presence of all tRNAs within the population (data not shown) ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA from human iPSC-RPE was isolated by adding 40 µL QuickExtract DNA Extraction Solution (Lucigen) to each well ...
-
bioRxiv - Cancer Biology 2023Quote: ... linear contaminant DNAs within the crude circular DNA are digested with Plasmid-Safe ATP-dependent DNase (Lucigen) at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted from cell pellets using the MasterPure™ Yeast DNA Purification Kit (Lucigen, cat #MPY80200), with an additional initial incubation with zymolyase at 37°C to enhance cell lysis ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from concentrated cells using the MasterPure complete DNA and RNA purification kit (Epicentre) and sequenced using P6 chemistry on a RS II instrument (Pacific Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted by using the MasterPure complete DNA and RNA purification kit (Epicentre, Madison, WI) as described by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated from these clones using the QuickExtract DNA extraction solution (Catalog No. QE09050, Lucigen) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... for sorting and then genomic DNA was extracted using the QuickExtract™ DNA Extraction Solution (QE09050, Epicentre), adhering to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... an aliquot of cells was used to extract the DNA by QuickExtractTM DNA Extraction Solution (Lucigen, QE09050). To assess the genomic editing efficiency ...
-
bioRxiv - Cell Biology 2020Quote: ... genomic DNA was isolated from single cell clones using the QuickExtract DNA extraction solution (Epicentre/Lucigen, Middleton, WI) according to manufacturer’s instructions and analyzed for the presence of the wildtype and knock-in Lmna allele by PCR using the GoTaq green master mix (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... genomic DNA was isolated from single cell clones using the QuickExtract DNA extraction solution (Epicentre/Lucigen, Middleton, WI) according to manufacturer’s instructions and analyzed for the presence of the wildtype and knock-in Lmna allele by PCR using the GoTaq green master mix (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA was extracted from modified cell lines using QuickExtract DNA extraction buffer (Epicentre Technologies, Madison, Wisconsin, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Biochemistry 2021Quote: ... the genomic DNA derived from transfected single cell colonies was extracted with QuickExtractTM DNA Extraction Solution (QE09050, Epicentre) for Sanger sequencing and the genomic DNA with biallelic editing was further subjected to whole-genome sequencing ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... genomic DNA from single colonies was extracted with the MasterPureTM DNA Purification Kit from Epicentre (Cat. No. MCD85201) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA for whole genome sequencing was extracted using the MasterPure™ Yeast DNA Purification kit (Lucigen, US) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from the cell pellets were extracted using a MasterPure™ DNA Extraction kit (Epicentre®, Madison, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Genetics 2024Quote: ... Genomic DNA was isolated from the thawed cell pellets using the MasterPure Yeast DNA Purification kit (Lucigen MPY80200). The DNA was digested with XhoI and NgoMIV and fractionated on a 0.6% agarose gel ...
-
bioRxiv - Microbiology 2024Quote: Microbial DNA extraction was performed following the MasterPure Complete DNA and RNA Purification Kit (Epicentre, Southampton, Hampshire, UK) and Pathogen Lysis Tubes (QIAGEN ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutant proteins were expressed in strain C41 (Lucigen) by induction at mid-log phase (OD600 ∼0.4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... genomic DNA was harvested using QuickExtract (Lucigen), and was saved until library preparation and sequencing.
-
bioRxiv - Biophysics 2020Quote: ... genomic DNA was isolated using QuickExtract (Lucigen), the sgRNA-targeted sites were PCR amplified and then NGS-sequenced via Genewiz’s EZ-Amplicon service ...
-
bioRxiv - Neuroscience 2021Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed using Q5® High-Fidelity DNA Polymerase according to the manufacturer’s protocol (Forward primer ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) as previously described (21) ...
-
bioRxiv - Genetics 2020Quote: ... Genomic DNAs were extracted by QuickExtract (Epicentre) solution and amplified by Phusion High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... and genomic DNA isolated using QuickExtract (Lucigen). The gRNA binding sites were amplified using KOD Hot Start Polymerase (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was collected using QuickExtract (Epicentre). Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline) ...
-
bioRxiv - Physiology 2024Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed ATG F (TGGAATCTTCTGAACAGGTGGA ...
-
bioRxiv - Microbiology 2024Quote: ... Klenow DNA Polymerase (KP810250, Epicentre, Madison, Wisconsin), and T4 Polynucleotide Kinase (EK0031 ...
-
bioRxiv - Neuroscience 2023Quote: QuickExtract™ DNA Extraction Solution (QE09050, Lucigen) was used to extract gDNA from the subclones for PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using QuickExtract (Epicentre) and PCR amplified across sgRNA sites (Table S1) ...
-
bioRxiv - Bioengineering 2023Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) and the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated using QuickExtract (Epicentre), incubated at 65°C for 6 minutes followed by an incubation at 95°C for 2 minutes using a thermal cycler ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 μL DNA QuickExtract solution (Lucigen QE09050) was added ...
-
bioRxiv - Neuroscience 2023Quote: DNA was prepared by either QuickExtract (Lucigen) from iPSCs or Qiagen DNeasy columns (MSNs and U2OS ...
-
bioRxiv - Neuroscience 2023Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed using Q5® High-Fidelity DNA Polymerase according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 μl QuickExtract DNA Extraction Solution (Lucigen) was used following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted using QuickExtract (Epicentre) and genotyping PCRs were performed with MyTaq HS Red Mix (Bioline ...
-
bioRxiv - Molecular Biology 2024Quote: ... or QuickExtract DNA extraction solution (Lucigen, #QE0905T) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... DNA was extracted from surviving cells (Lucigen QuickExtract or Qiagen DNeasy DNA blood and tissue kit ...
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) as previously described (17) ...