Labshake search
Citations for Agilent :
101 - 150 of 2411 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: Electron ionization GC/MS analysis was performed on a G3950A-9000 GC (Agilent) using a J&W HP-5ms Ultra Inert Intuvo GC column module (15 m length ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... PAH quantification was performed on GC/MS (Agilent 6890 GC, Agilent 5973n MS) equipped with a split/splitless injector kept in splitless mode and a DB5-MS capillary GC column (with a 30 m length x 0.32 diameter and 0.25 μm film thickness) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... PAH quantification was performed on GC/MS (Agilent 6890 GC, Agilent 5973n MS) equipped with a split/splitless injector kept in splitless mode and a DB5-MS capillary GC column (with a 30 m length x 0.32 diameter and 0.25 μm film thickness) ...
-
bioRxiv - Plant Biology 2022Quote: ... Data from GC-EI-MS was acquired with Agilent GC/MSD Chemstation (Agilent). Data from GC-CI-MS was acquired with Agilent MassHunter Workstation (Agilent) ...
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B ...
-
bioRxiv - Plant Biology 2023Quote: ... GC-MS data was acquired in splitless mode on a GC (Agilent instrument) equipped with an HP-5MS column (Agilent 19091S-433 ...
-
bioRxiv - Plant Biology 2021Quote: The data acquisition was performed on GC-MS (GC ALS-MS 5977B, Agilent Technologies) equipped with HP-5ms (5% phenyl methyl siloxane ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Brilliant II Sybr green reaction mix (Stratagene/Agilent, Stockport, UK) in a final reaction of 15 uLs ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Brilliant II Sybr green reaction mix (Stratagene/Agilent, Stockport, UK) in a final reaction of 15 uLs ...
-
bioRxiv - Cell Biology 2022Quote: ... Relative expression was assessed by qPCR with SyberGreen II mix (Agilent Technologies Thermocycler ...
-
bioRxiv - Neuroscience 2020Quote: ... the GC-MS device (Agilent GC 7890A fitted with an MS 5975C inert XL MSD unit ...
-
bioRxiv - Immunology 2023Quote: ... GC (Agilent 6890, Wilmington, DE) separation was performed using a ZB-Wax plus column ...
-
bioRxiv - Genomics 2020Quote: ... Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, #600882) was used for quantitative PCR ...
-
bioRxiv - Microbiology 2019Quote: ... For this experiment Brilliant III ultra-fast qRT-PCR master mix (Agilent) was used with ROX following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2019Quote: ... with Brilliant III Ultra-Fast SYBR Green QPCR master mix (Agilent, UK) and the primer pairs listed in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed using Brilliant SYBR Green qPCR master mix (Agilent Technology) with specific primers listed in Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a CFX96 Real-Time System Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A master mix of AffinityScript Multiple Temperature Reverse Transcriptase (Agilent, cat#600107) was prepared following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The LECO Pegasus 4D (LECO, St. Joseph, MI, USA) GC×GC– ToFMS system was comprised by an Agilent GC 7890A gas chromatograph (Agilent Technologies, Inc., Wilmington, DE), with a dual stage jet cryogenic modulator (licensed from Zoex ...
-
bioRxiv - Immunology 2023Quote: ... Reactions were performed in a 25 μl reaction mix comprising 1X Taqman Brilliant III master mix (Agilent, Stockport, UK), 0.2 pmol/μl forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were analyzed using a GC-MS (Agilent 7890A GC system, Agilent 5975C MS detector) operating in electron impact ionization mode ...
-
bioRxiv - Microbiology 2021Quote: ... coupled with a mass spectrometer (GC-MS) (Agilent 5975C GC MSD; Agilent, Santa Clara, CA).
-
bioRxiv - Microbiology 2021Quote: ... coupled with a mass spectrometer (GC-MS) (Agilent 5975C GC MSD; Agilent, Santa Clara, CA).
-
bioRxiv - Microbiology 2019Quote: ... The Duran bottles were linked to a Micro-GC (Agilent 490 micro-GC, Agilent Technologies) for the continuous monitoring of the methane production over two weeks ...
-
bioRxiv - Microbiology 2019Quote: ... The Duran bottles were linked to a Micro-GC (Agilent 490 micro-GC, Agilent Technologies) for the continuous monitoring of the methane production over two weeks ...
-
bioRxiv - Microbiology 2021Quote: ... Samples (2 µL) were injected into a 7890B GC/5977A GC/MSD system (Agilent Technologies) with a DB-Wax capillary column (60 m length ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... we used a GC/MS single quadrupole (GC 7890 - MS 5975, Agilent, Santa Clara, CA). Front SS Inlet was set in splitless mode at 280°C and carrier gas was Helium at constant flow rate of 2 ml/min ...
-
bioRxiv - Microbiology 2021Quote: ... The GC × GC system consisted of an Agilent 7890 A (Agilent Technologies, Santa Clara, CA) equipped with a Pegasus IV time-of-flight mass spectrometer (Leco Corporation ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were analysed using GC-MS (7890A GC system, 5975C MSD, Agilent, Santa Clara, CA). To measure conversions ...
-
bioRxiv - Bioengineering 2022Quote: ... The supernatant was filtered (0.22 µm) and analyzed by gas chromatography (GC, Agilent gc 6890n) using a DB-1701 column (Agilent ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Samples were analyzed using a GC-MS (Agilent 7890A GC system, Agilent 5975C MS detector) operating in electron impact ionization mode ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were analyzed using a GC-MS (Agilent 7890A GC system, Agilent 5975C MS detector) operating in electron impact ionization mode ...
-
bioRxiv - Plant Biology 2024Quote: ... The data acquisition was carried out using GC-MS (GC ALS-MS 5977B, Agilent Technologies) equipped with an HP-5MS (5% phenyl methyl siloxane ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were performed using Brilliant III Fast SYBR-Green QPCR Master Mix (Agilent) on a QuantStudio 3 real-time PCR instrument (ThermoFisher) ...
-
bioRxiv - Genetics 2019Quote: ... A Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies) was used for cDNA amplification ...
-
bioRxiv - Biochemistry 2020Quote: ... with Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies) under the following conditions ...
-
bioRxiv - Physiology 2022Quote: ... Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, Tokyo, Japan), 250 nM of each primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Les Ulis, France) on the MX3005P Stratagene instrument ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was used for RT-qPCR with miRNA QPCR Master Mix (Agilent Technologies). Universal reverse primers (Agilent Technologies ...
-
bioRxiv - Zoology 2023Quote: ... 1×Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies 600882) was used with intron spanning ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10µl of Brilliant III Ultra-Fast SYBR® Green PCR Master Mix (Agilent), and finally 25 ng of DNA sample from infected oysters or Milli-Q water (non-template control ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was carried out with SYBR Green PCR master mix (Agilent, 600882) on cDNA (diluted 1:5 in water) ...
-
bioRxiv - Plant Biology 2020Quote: ... Samples were directly analyzed by GC-MS with a 7890B/5977A GC-MS system from Agilent and according to a protocol adapted from Laville et al ...
-
bioRxiv - Molecular Biology 2020Quote: - GC column (J&W DB-5ms GC Column with 10m DuraGuard, Cat# 122-5532G, Agilent Technologies)
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... GC/MS chromatograms were analyzed by the GC/MSD ChemStation software (Agilent Technology, Santa Clara, CA).
-
bioRxiv - Plant Biology 2022Quote: Glucose and Fructose were analyzed by GC-CI-MS by an Agilent 7890B GC system (Agilent) coupled to an Agilent 7010B triple quadrupole GC/MS with an autosampler (CTC PAL ...
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B, MS: Agilent 5977B ...
-
bioRxiv - Synthetic Biology 2023Quote: GC-MS analysis was carried out on an Agilent 7890B GC machine (Agilent Technologies, Waldbronn, USA) with an Agilent 7000C mass selective detector at 70 eV and a helium flow of 1.0 mL min-1 ...
-
bioRxiv - Microbiology 2023Quote: Culture supernatants were analyzed using a GC-MS (Agilent 7890A GC system, Agilent 5975C MS detector) with an electron impact ionization source ...
-
bioRxiv - Physiology 2022Quote: ... and analyzed by GC–QQQ (Agilent 8890 GC coupled to Agilent 7010B GC-QQQ ...