Labshake search
Citations for Agilent :
1 - 50 of 2411 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 12.5 μL of 2x Brilliant II SYBR Green Master Mix with low ROX (Agilent), and 9.3 μL of nuclease-free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR amplification (PFU Ultra II HS 2x master mix from Agilent, 600850-51) according to manufacturer’s protocols ...
-
bioRxiv - Physiology 2022Quote: ... hIP3R3 and hIP3R1 were generated using Pfu Ultra II Hotstart 2X Master Mix (Agilent Technologies) and appropriate primers obtained from Integrated DNA Technologies (Table ...
-
bioRxiv - Biophysics 2022Quote: ... Mutagenesis and all DNA modifications were carried out using Pfu Ultra II Hotstart 2X Master Mix (Agilent). Mutagenesis primers for hIP3R1 F2586K forward (TCTTCATGGTCATCATCATTGTTCTTAACCTGATTAAGGGGGTTATCATTGACACT) ...
-
bioRxiv - Neuroscience 2023Quote: ... Brilliant II SYBR Green QPCR master mix (Agilent) was used to make the reaction mix ...
-
bioRxiv - Cell Biology 2019Quote: ... was then performed with SYBR Green 2x Master Mix (Applied Biosciences) or Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) utilizing the EPA1qPCR F and EPA1qPCR R primer set to amplify the EPA1 amplicon ...
-
bioRxiv - Immunology 2020Quote: ... using Brilliant II SYBR Green QPCR Master Mix (Agilent), followed by ViiA 7 RUO Software for the determination of Ct values ...
-
bioRxiv - Cell Biology 2022Quote: ... using Brilliant II SYBR Green QPCR Master Mix (Agilent). Results were analysed by the comparative Ct method using ViiA 7 RUO software ...
-
bioRxiv - Cell Biology 2023Quote: ... using SYBR Green PCR Master Mix II (Agilent Technologies). Amplicons representing target genes and the endogenous housekeeping gene ...
-
bioRxiv - Plant Biology 2022Quote: ... 2X Brilliant III SYBR® Green QPCR master mix (Agilent Technologies, USA) was used for a qRT-PCR reaction carried out in a Stratagene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Plant Biology 2022Quote: ... 2X Brilliant III SYBR® Green QPCR master mix (Agilent Technologies, USA) was used for a qRT-PCR reaction carried out in a Stratagene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... using qRT-PCR Brilliant II Probe Master Mix (Agilent Technologies) with a TaqMan™ TAMRA Probe system (Applied Biosystems) ...
-
bioRxiv - Genomics 2019Quote: ... 10 μl of Brilliant II SYBR® master mix (Agilent Technologies) and 100 nm of each forward and reverse primer ...
-
bioRxiv - Developmental Biology 2019Quote: ... Brilliant II 1-step qPCR master mix (Agilent, Santa Clara, CA) was used following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... QPCR was carried out using Brilliant II SYBR master mix (Agilent Technologies India Pvt Ltd ...
-
bioRxiv - Plant Biology 2024Quote: ... QPCR was conducted utilizing Brilliant II SYBR master mix from Agilent Technologies
-
bioRxiv - Cell Biology 2020Quote: ... using Brilliant II SYBR Green QPCR Master Mix (Agilent, Santa Clara, CA). Results were analysed by the comparative Ct method using ViiA 7 RUO software ...
-
bioRxiv - Immunology 2020Quote: ... and Brilliant II SYBR Green Master Mix (600830; Agilent, Santa Clara, CA). Primer pairs used for amplification of specific gene products are as follows ...
-
bioRxiv - Pathology 2022Quote: ... The 15 μl of reactional mix were composed of 1x Brillant II qPCR master mix (Agilent Technologies), 0.03 μM ref dye provided with the master mix ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent) and a Stratagene Mx3000PQ-PCR machine ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent) and a Stratagene Mx3000PQ-PCR machine ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR reactions were assembled using Brilliant II SYBR low ROX master mix (Agilent) using 1 μl of diluted cDNA (1/100) ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA expression was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent) using a ViiA 7 Real-Time PCR system (Thermo Fisher Scientific ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... QPCR was performed using RealQ Plus 2x Master Mix Green (Ampliqon, #A324402) on Stratagene Mx3005P (Agilent Technologies) and Quant Studio 5 (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... qPCR was performed with Brilliant II SYBR® Green QPCR Master Mix (Agilent Technologies) in a LightCycler® 480 Instrument II (Roche) ...
-
bioRxiv - Genetics 2020Quote: qPCR was performed with Brilliant II SYBR® Green qPCR Master Mix (Agilent Technologies) in a LightCycler® 480 Instrument II (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies). qPCR reaction and data were acquired on an Agilent Mx3005P qPCR System.
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed using the Brilliant II SYBR Green QPCR Master mix (Agilent) in real time PCR (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and was analyzed by qPCR using the Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... we used Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent).
-
bioRxiv - Cell Biology 2019Quote: ... MCM7 forward: CCCCTCTTTCTCCCATGCTG reverse: AGGCCCAGGCTAGAAGATGA) and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828).
-
bioRxiv - Microbiology 2022Quote: ... Quantitative qRT-PCR was performed with the Brilliant II SYBR Green QPCR Master Mix (Agilent). Primers were designed to amplify ∼150 bp product within the target genes ...
-
bioRxiv - Microbiology 2023Quote: ... and qPCR was performed using the Brilliant II SYBR® Green QPCR master mix (Agilent). PCR primer sequences included XIAP (F ...
-
bioRxiv - Neuroscience 2023Quote: qRT-PCR reactions were performed using Brilliant II SYBR Green qPCR Master Mix (Agilent #600828) according to manufacturer instructions using a Light Cycler HT7900 (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with Brilliant II Ultra-Fast SYBR® Green QPCR Master Mix (Agilent) using a Bio-Rad CFX96 Real-Time Detection System ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR using Brilliant II SYBR® Green QPCR Master Mix (Agilent, Santa Clara, CA, USA) was outperformed on CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... In case of ELF1α amplification was carried out in a 15 μL reaction volume containing 7.5 μL of 2X Brilliant III Ultra-Fast SYBR® Green QRT-PCR Master Mix (Stratagene), 0.75 μL of each forward and reverse primers (0.5 μM) ...
-
bioRxiv - Cell Biology 2020Quote: ... quantified by performing PCR reaction using Brilliant II SYBR® Green QPCR Master Mix (Agilent Technologies, USA). The primer sequences for PCR analysis were as follows ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was performed on a Stratagene 3000 qPCR system using Brilliant II SYBR Master Mix (Agilent – 600828). Primer sequences are in Supplementary Data 1 ...
-
bioRxiv - Genetics 2023Quote: ... Real-time PCR was done in duplicate with Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) and primers from IDTDna ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed using the Brilliant II SYBR Green QPCR master mix (Agilent Technologies, Santa Clara, CA). The primers used are listed in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LTM Series II Fast GC Module, 7000C GC-MS/MS Triple Quadrupole, 7693 Autosampler and 7697A Headspace Sampler, all Agilent Technologies). The prepared samples were injected into the GC using the following conditions (1 µL pulsed split-less injection at 235 °C ...
-
bioRxiv - Genetics 2021Quote: ... Real-time PCR reactions were performed with the Brilliant II SYBR® Green QPCR Master Mix (Agilent, 600828). The relative quantification in gene expression was carried out using the 2- ΔΔCt method (51) ...
-
bioRxiv - Cell Biology 2023Quote: ... Von Zastrow lab).The DNA fragments were amplified by Pfu Ultra II Hotstart PCR master mix (Agilent Technologies) and ligated with each respective vector by NEBbuilder HiFi DNA assembly master mix (New England BioLabs).
-
bioRxiv - Biochemistry 2021Quote: ... Selected residues were mutated to alanine or oppositely-charged amino acids by PfuUltra II Hotstart PCR Master Mix (Agilent). All mutated sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was performed using Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent). We analyzed enrichment for target histone modifications by amplifying unique DNA barcodes at the 3’ end ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative PCR was performed using the 1-Step Brilliant II SYBR Green QRT-PCR Master Mix kit (Agilent Technologies) and the TaqPath 1-Step Multiplex Master Mix kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... using SYBR Green qPCR master Mix (Agilent) and gene-specific oligonucleotides (Table S5 ...
-
bioRxiv - Genomics 2019Quote: ... qRT-PCR was run on a Roche Lightcycler 480 using the Brilliant II SYBR Green qPCR Master Mix (Stratagene, 600804) using the following primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... single strand cDNA synthesis and PCR amplification were carried out in a 1-step reaction using the Brilliant II QRT-PCR Master Mix (Agilent) and TaqMan gene expression assays (Life Technologies) ...