Labshake search
Citations for Agilent :
51 - 100 of 2411 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was carried out using 10-fold diluted cDNA and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828) with the appropriate primer pairs (listed in Supplementary Table 3 ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed in a 25 μL reaction volume consisting of 12.5 μL Brilliant II SYBR Green Master Mix (Agilent Technologies), 1.0 μL of 10 μM forward DSR-1F (5’-ACS CAC TGG AAG CAC GGC GG −3’ ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were performed using Brilliant II SYBR® Green qPCR master mix with low ROX (Agilent Technologies, Cedar Creek, TX) and monitored on a Stratagene® Mx3000P cycler (Agilent Technologies) ...
-
bioRxiv - Genetics 2019Quote: ... All qRT-PCR experiments were performed on diluted cDNA (1:5 in nuclease-free water) using the Brilliant II SYBR Green qPCR Master Mix (Agilent Technologies) and the 7900HT Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2021Quote: ... Mutations were cloned into the expression vector by polymerase chain reaction (PCR) using a PFUultra II Hotstart PCR Master Mix (Agilent Technologies). The obtained PCR products were subsequently treated with DPNI (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of cDNA was used for SYBR green qPCR using Brilliant II SYBR Green QPCR Master Mix with Low ROX (Agilent #600830) in Bio-Rad Hard Shell PCR 96-well plates (Bio-Rad #64201794 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Real time quantification of mRNA levels of the genes of interest was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RT-qPCR was performed using the 1-Step Brilliant II SYBR Green quantitative RT-PCR master mix kit (Agilent Technologies) on a Bio-Rad C1000 Thermal Cycler CFX96 Real-Time System ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Genomics 2023Quote: ... Real time quantification of mRNA levels of the genes of interest was performed using Brilliant II SYBR Green QPCR Master Mix (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... was carried out in a 25 μL reaction volume using the Brilliant II SYBR Green PCR Master Mix (Stratagene, Agilent technologies). Primer concentrations were set at 0.2 μM ...
-
bioRxiv - Immunology 2020Quote: ... with a Brilliant III SYBR master mix (Agilent) and specific primer pairs ...
-
bioRxiv - Immunology 2022Quote: ... master mix on a Mx3005P System (Agilent Technologies). Each assay was run in triplicate using 15µl of reaction mix containing 7.5ul Brilliant III Ultra-Fast SYBR Green (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative real-time polymerase chain reaction (qPCR) was performed in triplicate using master mix (Brilliant III Ultra-Fast SYBR Green QPCR Master Mix, Agilent Technologies) and a real-time PCR system (AriaMax Real PCR System ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-C1-tubbyCT KR330/332AA was generated by mutagenesis PCR using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, US).
-
bioRxiv - Synthetic Biology 2021Quote: 384 well qPCR reaction plates for the multiplexed activation of endogenous genes (Figure 5 and 6) were set up using the Brilliant II SYBR master mix (Agilent cat #600828) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The expression levels of selected genes were analyzed using SYBR Green chemistry (Brilliant II SYBR Green qPCR master mix (Agilent Technologies, USA) in the Stratagene mx3005P instrument (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: Quantitative PCR (qPCR) was carried out in a 25 μL reaction volume using the Brilliant II SYBR Green PCR Master Mix (Stratagene, Agilent technologies). Primer concentrations were set at 0.2 μM ...
-
bioRxiv - Plant Biology 2022Quote: ... using Brilliant III UltraFast SYBR QPCR Master Mix (Agilent). Primers are listed in Supplemental Table 2 ...
-
bioRxiv - Pathology 2021Quote: ... using Brilliant III Ultra-Fast QPCR Master Mix (Agilent) following the supplier’s recommendations (5 μl DNA at 10 ng μl-1 in a total reaction volume of 20 μl) ...
-
bioRxiv - Microbiology 2023Quote: ... using Brilliant III Ultra-Fast SyberGreen Master Mix (Agilent), and 567F and 680R primers at 0.3 μM ...
-
bioRxiv - Immunology 2023Quote: ... and a Brilliant III SYBR Green Master mix (Agilent) including specific primer pairs (Supplementary Table 3) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GC-MS analysis was performed using a 7890B GC (Agilent) as previously described (Hodgson et al. ...
-
bioRxiv - Pathology 2020Quote: ... beads were collected for 2 min on a magnet and then resuspended in 25 µL PCR master mix containing PCR1 primers and Herculase-II (Agilent, Santa Clara CA). PCR cycling was as follows ...
-
bioRxiv - Systems Biology 2020Quote: GC-MS (Agilent), Microplate reader (ELx 808 ...
-
bioRxiv - Plant Biology 2020Quote: ... GC (Agilent 7890A) oven temperature at injection was 80°C ...
-
bioRxiv - Physiology 2022Quote: ... and analyzed by GC–QQQ (Agilent 8890 GC coupled to Agilent 7010B GC-QQQ, Santa Clara, CA, USA) on a DB-17 column with negative chemical ionization ...
-
Variation of wine preference amongst consumers is influenced by the composition of salivary proteinsbioRxiv - Biochemistry 2023Quote: GC×GC−MS analysis was carried out with an Agilent 7890A GC system (Agilent Technologies, Mulgrave, VIC, Australia) equipped with an SSM1800 solid state modulator (J&X Technologies Co ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... sex and karyotype were analyzed on a GC (Agilent GC 6890) coupled to a MS (Agilent 5973 MSD ...
-
bioRxiv - Microbiology 2019Quote: ... gas composition using Micro-GC (Agilent 490 micro-GC, Agilent Technologies) and the lactate ...
-
bioRxiv - Microbiology 2019Quote: ... gas composition using Micro-GC (Agilent 490 micro-GC, Agilent Technologies) and the lactate ...
-
bioRxiv - Biochemistry 2023Quote: Prepared GC samples were run on a 7890B Network GC (Agilent) equipped with an 7693A Autosampler (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed as previously described (Sodi et al., 2015) using Brilliant II qRT-PCR Master Mix 2 Kit (Stratagene, San Diego, CA, USA) using Applied Biosystems 7500 machine. ...
-
bioRxiv - Developmental Biology 2020Quote: ... Brilliant III SYBR® green QPCR Master Mix (Agilent Technologies) was used for qRT-PCR and reactions run on a Roche LightCycler®96 real time PCR system ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR Brilliant III ultra-fast master mix kit (Agilent) and TaqMan gene expression probes (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Brilliant iii Ultra Fast SYBR green qPCR master mix (Agilent) and Chicken primers were used at 100nM final and were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The identification was performed by GC (HP 6890 Series GC System; Agilent) [27] ...
-
bioRxiv - Developmental Biology 2022Quote: ... The transfer line from GC column to MS (Agilent 5977B GC/MSD) was set to 250 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... The concentration of 2-PE was measured by GC (Agilent gc 6890n) equipped with a DB-1701 column (Agilent ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... The GC-MS (Agilent GC 7890A fitted with an MS 5975C inert XL MSD unit ...
-
bioRxiv - Microbiology 2022Quote: ... A GC device (Agilent 7890A device ...
-
bioRxiv - Plant Biology 2019Quote: ... or Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent) with a 96-well CFX96 Touch Real-Time PCR detection system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent). A total of 10 ng of cDNA from each sample was used as template in a three-step program involving a denaturation at 95 °C for 3 min followed by 40 cycles of 10 s at 95 °C and 10 s at 60 °C and a last step of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... and Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent). Oligonucleotides (final concentration 0.6 M ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Brilliant III SYBR® Green QPCR Master Mix (Agilent Technologies) was used according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent). A total of 10 ng of cDNA from each sample was used as template in a three-step program involving a denaturation at 95 °C for 3 min followed by 40 cycles of 10 s at 95 °C and 10 s at 60 °C and a last step of 1 min at 95 °C ...
-
bioRxiv - Bioengineering 2019Quote: ... Analysis was followed in GC-MS (7890B GC System /5977B MSD Agilent Technologies).
-
bioRxiv - Microbiology 2021Quote: ... The GC-MS system (7890B GC coupled to a 5977B MS, Agilent Technologies) was equipped with an autosampler and a split/splitless inlet kept at 300°C ...