Labshake search
Citations for Agilent :
251 - 300 of 2411 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The dried FAME samples were dissolved in 20 μL dichloromethane and analysed by injection of 1 μL into a GC-MS (GC-6890N, MS detector-5973; Agilent Technologies) using a ZB-5 column (30 m × 25 mm × 25 mm ...
-
bioRxiv - Genomics 2020Quote: Derivatized urine samples and reagent blank samples were injected onto a Pegasus 4D GC×GC-TOF MS system equipped with an Agilent 7890 gas chromatograph (Agilent Technologies) in line with a LECO Time-of-Flight mass spectrometer (LECO Corp ...
-
bioRxiv - Bioengineering 2022Quote: ... samples (50 μL) were injected into a gas chromatograph (GC) system coupled with a thermal conductivity detector (GC-TCD, Agilent 8860) with a 5-Å column (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... GC-MS analysis was performed using an Agilent 7890B GC coupled to an Agilent 5977 A Mass Selective Detector (Agilent Technologies). A sample volume of 1 μl was injected into a Split/Splitless inlet ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Plant Biology 2023Quote: ... the samples were concentrated to approximately 100 μL with nitrogen blow and subjected to GC-MS analysis with a GC (Agilent 6890) equipped with a DB-1 capillary column (15 m/0.25 mm/0.25 µm ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl of that was injected into a gas chromatograph coupled to the mass detector (GC-MS, 7890B GC, 5977C MSD, Agilent Technologies). It consisted HP-5MS capillary column to separate the analytes and used helium as carrier gas with a flow rate of 1 ml/min ...
-
bioRxiv - Cell Biology 2023Quote: ... GC separation was performed with the 30 m–0.250 (i.d.) GC DB-5MS UI fused silica column (Agilent Technologies, CA, USA), chemically bonded with a 5% diphenyl 95% dimethylpolysiloxane cross-linked stationary phase (0.25 mm film thickness) ...
-
bioRxiv - Systems Biology 2023Quote: ... Supernatants were collected and several fractions were split to be analysed by different Liquid and Gaz chromatography coupled with mass spectrometers (LC/MS and GC/MS)86.Widely targeted analysis by GC-MS/MS was performed on a coupling 7890A gas chromatography (Agilent Technologies) Triple Quadrupole 7000C (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The obtained AMG were analyzed via gas chromatography-mass spectrometry (GC-MS) on an Agilent instrument (GC instrument Agilent 6850 coupled to MS Agilent 5973) equipped with a SPB-5 capillary column (Supelco ...
-
bioRxiv - Neuroscience 2019Quote: ... Gas chromatography–mass spectrometry (GC/MS) analysis was performed on an Agilent 7890B GC - Agilent 7010 Triple Quadrapole Mass Spectrometer system (Agilent, California, USA). Dopamine (DA) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Plant Biology 2021Quote: ... The GC-MS system consisted of a GC PAL autosampler (CTC Analytics, Zwingen, Switzerland) combined with a column oven (7890A Agilent Technologies, USA) and Pegasus HT GC-MS/QTOF (Leco ...
-
bioRxiv - Plant Biology 2021Quote: GC-FID analysis of FAMEs was performed as described (Hornung, Pernstich and Feussner, 2002): an Agilent GC 6890 system (Agilent, Waldbronn, Germany) coupled with an FID detector equipped with a capillary DB-23 column (30 m × 0.25 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... were analyzed using TriPlus RSH autosampler and Trace 1310 gas chromatography (GC) system having a 50 m x 0.25 mm FAME GC column of film thickness 0.25 um (Agilent Technologies, Santa Clara, CA) and coupled to a TSQ 8000 mass spectrometer (MS ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant was transferred to GC vial inserts for GC-MS analysis using a 7890 Gas Chromatograph (Agilent Technologies, Santa Clara, CA) coupled to a Pegasus 4D GC × GC time-of-flight mass spectrometer (LECO Corporation) ...
-
Mass spectrometric analysis and biostimulatory effects of boar seminal gel, saliva and semen in pigsbioRxiv - Animal Behavior and Cognition 2023Quote: ... An aliquot of 1 μL was injected into GC-MS (GC 9000 and MS of G7077B, Agilent Technologies, Palo Alto, CA, USA) for further analysis ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 100 μL of the ethyl acetate phase was transferred into a GC vial with insert and 1 μL was analyzed using GC 8890 (Agilent Technologies, USA) equipped with a flame ionization detector (FID ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting cDNA was mixed with Brilliant III Ultra-Fast SYBR QPCR master mix (Agilent Cat#600883) and primers ...
-
bioRxiv - Microbiology 2022Quote: ... 200 nM of each primer and 1X Brilliant III Ultra-Fast SybrGreen qPCR Master Mix (Agilent Technologies). The RT-qPCR reactions were performed on a QIAGEN Rotor-Gene Q instrument (Corbett Research ...
-
bioRxiv - Cell Biology 2020Quote: ... and qPCR was performed with the Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies) on a QuantStudio 3 machine (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... qPCRs were performed in triplicate with Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies) on an ABI 1900HT qPCR machine.
-
bioRxiv - Microbiology 2021Quote: Real-time RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... RT–qPCR reactions were performed using Brilliant III Ultra-Fast SYBR Green qPCR Master mix (Agilent Technologies) with the relevant primers (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed by using the Brilliant III SYBR® Green QPCR Master Mix (Agilent #600882) or DyNAmo HS SYBR Green (Thermo Scientific #F410L ...
-
bioRxiv - Systems Biology 2020Quote: ... 0.5 μl 10 mM dNTP mix and 0.5 μl Herculase II fusion DNA polymerase (Agilent Technologies). PCR parameters were as follows ...
-
bioRxiv - Cancer Biology 2019Quote: ... resuspended in 20 µL of a Herculase II-containing PCR mix (catalog number 600679, Agilent Technologies), and ran for 20 PCR cycles followed by a second 20-cycle PCR using 2 µL of the initial PCR products to add barcodes and P5/P7 Illumina sequencing adapters ...
-
bioRxiv - Immunology 2024Quote: Real-time ChIP-qPCR was performed with the Brilliant II SYBR green super mix (Agilent, USA). Forward (AGTGGTGACCTTGAACTTCCC ...
-
bioRxiv - Microbiology 2019Quote: ... connected to a 7000 GC/MS Triple Quad (Agilent). The gas chromatograph was equipped with a fused silica capillary column (25 m x 0.32 mm ...
-
bioRxiv - Systems Biology 2021Quote: The analysis was performed with a GC system (Agilent) fitted with a DB-5ms capillary column (15 m × 0.18 mm internal diameter × 0.18 μm film with 5 m Duraguard integrated guard column ...
-
bioRxiv - Bioengineering 2020Quote: Patchoulol in dodecane was quantified via GC-MS (Agilent 7890A gas chromatograph interfaced with an Agilent 5975C inert MSD with Triple-Axis Detector) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ethanol concentrations were thereafter determined by GC-MS (Agilent 7820A GC coupled to a 7697A headspace sampler ...
-
bioRxiv - Physiology 2021Quote: Palmitate isotopic enrichments were measured by GC-MS (Agilent models 6890 and 5973 ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were depolymerized and analyzed by GC-MS (Agilent 6890N-Agilent 5973N quadrupole mass-selective detector ...
-
bioRxiv - Physiology 2021Quote: ... and 2.0 μL were injected in GC-MS (Agilent Technologies 8860 GC System ...
-
bioRxiv - Microbiology 2020Quote: ... The holder was inserted into the GC injector (Agilent 5973 Network Mass Spectrometer - Agilent model 6890N gas chromatograph ...
-
bioRxiv - Bioengineering 2022Quote: ... The products were identified by a GC (Agilent 7890B) mass spectrometer (MS ...
-
bioRxiv - Plant Biology 2023Quote: ... The derivatives were then analyzed by GC-MS (Agilent: 7820A GC and 5977B quadrupole MS ...
-
bioRxiv - Plant Biology 2023Quote: ... and processed by gas chromatography (GC) (7890N and Agilent) using the time of flight coupled with a mass spectrometry (Pegasus HT and Leco ...
-
bioRxiv - Bioengineering 2023Quote: ... equipped with an HP-PLOT Moleseive GC column (Agilent 19095P-MS6 ...
-
bioRxiv - Biochemistry 2022Quote: ... centrifuged and transferred into polypropylene GC/MS vials (Agilent). Nonpolar metabolites were treated by incubating dried samples in each microcentrifuge tube with 500 µL methanol with 2 vol % sulfuric acid at 60 °C for 3 hours ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... GC–MS instrumentation and software were all from Agilent. GC–MS methods and analyses are as previously described (Hulea et al ...
-
bioRxiv - Microbiology 2023Quote: ... Volatiles were introduced into the GC-Q-TOF (Agilent 7890B GC and Agilent 7200A QTOF ...
-
bioRxiv - Plant Biology 2023Quote: ... Samples were analyzed on a 7890B Network GC (Agilent) equipped with an 7693A Autosampler (Agilent ...
-
bioRxiv - Microbiology 2023Quote: Culture supernatants were analyzed using a GC-MS (Agilent 7890A GC system ...
-
bioRxiv - Bioengineering 2023Quote: ... and n-caprylate by an Agilent 7890B GC (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were analysed on an 8890 GC System (Agilent) equipped with a DB5 capillary column (J&W Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The desorbed VOCs were subsequently collected on a cold trap at −10°C and introduced into a GC-QTOF (model Agilent 7890B GC and the Agilent 7200AB QTOF, USA) by heating the cold trap for 10 min to 280°C ...
-
bioRxiv - Systems Biology 2019Quote: ... USA) into the 2D GC-MS system consisting of an Agilent©7890 B gas chromatograph (GC) (Agilent Technologies, Palo Alto, CA, USA) connected to a Pegasus ® 4D ToF-MS mass spectrometer (LECO Corp. ...