Labshake search
Citations for Agilent :
1951 - 2000 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The samples quantity and purity were determined using a NanoDrop spectrophotometer while the 4C PCR library efficiency and the absence of primer dimers were reconfirmed by Agilent Bioanalyzer ...
-
bioRxiv - Systems Biology 2023Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Immunology 2023Quote: ... PCR products of enhancers were amplified in a mix of PfuUltra DNA Polymerase (600385-51, Agilent Technologies, Santa Clara, CA) and Taq DNA polymerase (M7123 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified capture products was then amplified using the SureSelect Post-Capture Indexing forward and Index PCR reverse primers (Agilent) for 12 cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... The adapter-modified DNA fragments were enriched by 4 cycles of PCR using SureSelect forward and SureSelect ILM Pre-Capture Indexing reverse (Agilent) primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Then quantification of viral copy numbers was carried out in duplicate by quantitative PCR using a Mx3005 P Thermocycler (Agilent) as described by [49] ...
-
bioRxiv - Microbiology 2023Quote: ... pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+) (Stratagene). pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Cancer Biology 2023Quote: ... The final libraries were generated by PCR amplification using PfuTurbo Cx Hotstart DNA polymerase (Agilent technologies, Santa Clara, CA, USA). RRBS libraries were analyzed by an Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: Genes of interest were PCR cloned from either cDNA or gDNA of N2 Bristol strain using PfuUltra II Fusion HS DNA polymerase (Agilent). Amplicon was ligated into pSM vector backbone for expression in C ...
-
bioRxiv - Microbiology 2023Quote: ... The transformation reactions were plated on LB-carbenicillin agar plates and colonies screened by PCR using Herculase II Fusion Pfu DNA Polymerase (Agilent) followed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of the genomic DNA was adjusted to 200 ng/µL before it was PCR amplified using Herculase II (Agilent). Approximately 400 ng purified PCR product (PCR purification kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA obtained from cell cultures transfected with the RNP complex was amplified by nested PCR using Herculase II Fusion DNA Polymerase (Agilent). The first amplification was performed with primers IG36 and IG37 as follows ...
-
bioRxiv - Biophysics 2023Quote: ... The His-TEV-mRaichu coding sequence was amplified by PCR using the primers GACGAATTCATGAATCACAAAGTGCATCAT and CTCGACAAGCTTTTAGATTCTGTGCTTTTAAGC and was inserted into the SmaI site of pBCKS (Stratagene). The coding sequence in the resultant plasmid was subcloned into the pFastBac™ Dual Expression Vector (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutagenesis was performed based on PCR of the full-length plasmid by using Pfu Turbo DNA polymerase (Stratagene). The entire cDNA was sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by PCR using the primers with Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA). PCR products were separated by electrophoresis through a 2% agarose gel in 1× TBE and stained with GelRed (Biotium ...
-
bioRxiv - Cancer Biology 2023Quote: ... Number of pre-capture PCR cycles was 8 - 14 based on input DNA quantity and quality (assessed by Agilent TapeStation) as advised by the manufacturers’ protocol and run on an AB Veriti 96-well Thermocycler (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... The synthesized cDNA was subsequently used as template for quantitative real time PCR based analysis of the expression levels of the target genes using Brilliant III Ultra-Fast SYBR QPCR MM (Agilent) in conjunction with Rotor-Gene® Q (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR mixes were made up as follows in a total volume of 50 µL: 1X Pfu reaction buffer (Agilent, #600250), 0.2 mM dNTP (NEB® ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR-amplified library was purified using Ampure XP beads and its quality was assessed on a Bioanalyzer 2100 system (Agilent). Diluted libraries were clustered on a pair-read flowcell and sequenced using a NovaSeq 6000 system (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... each library underwent a reconditioning PCR to reduce heteroduplexes: libraries were concentrated down to 5 µl and mixed with 10 µl of Herculase Buffer (Agilent), 5 µl of 2.5 nM dNTPs ...
-
bioRxiv - Plant Biology 2020Quote: ... A Bioanalyzer 2100 (Agilent, High Sensitivity DNA Kit) was used for library quality control ...
-
bioRxiv - Cancer Biology 2021Quote: ... and using the High Sensitivity dsDNA kit (Agilent) on the Agilent 2100 Bio-Analyzer ...
-
bioRxiv - Microbiology 2020Quote: ... run using the RNA 6000 Pico Kit (Agilent). To evaluate the extent of remaining buffer and DNA contaminations ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell glycolysis Test Kit (Agilent, 103020), was used for the assay ...
-
bioRxiv - Cell Biology 2020Quote: ... An Agilent 2100 BioAnalyzer and DNA1000 kit (Agilent) were used to quantify amplified cDNA and to control the quality of the libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... PTHrP staining was visualized with diaminobenzidine kit (Dako) and conterstained with Mayer’s hematoxylin ...
-
bioRxiv - Cell Biology 2020Quote: ... using QuikChange site-directed mutagenesis kit (#200515, Agilent). U2OS cells were transfected with the plasmids by electroporation ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Agilent High Sensitivity DNA kit (Agilent) and concentration was determined using QuantiFluor ONE ds DNAsystem on Quantus fluorometer (Promega) ...
-
bioRxiv - Developmental Biology 2020Quote: The SureSelect Exome Enrichment kit V7 (Agilent Technologies) was used to enrich exome sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) was used.
-
bioRxiv - Molecular Biology 2021Quote: ... the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) was used.
-
bioRxiv - Molecular Biology 2020Quote: ... Seahorse XF Cell Mito Stress kit (Agilent Technologies) was used according to manufacturer’s instructions and modified for zebrafish purposes as described in previous publications [80–82] ...
-
bioRxiv - Molecular Biology 2019Quote: ... with a High Sensitivity DNA Kit (Agilent Technologies). The majority of samples were sequenced using a MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... using a RNA 6000 Nano Kit (Agilent Technologies), respectively ...
-
bioRxiv - Genomics 2020Quote: ... using the High sensitivity DNA kit (Agilent Technologies) assuming a targeted 200 base-read library.
-
bioRxiv - Genomics 2020Quote: ... and Bioanalyzer Pico 6000 kit (Agilent Technologies, USA), respectively ...
-
bioRxiv - Plant Biology 2020Quote: All RNA samples integrity were analyzed by Agilent RNA 6000 Nano kit (Agilent Technologies, Waldbronn, Germany) on a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... using the gene expression hybridization kit from Agilent (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... using the Gene Expression Hybridization kit (Agilent Technologies). Array digitalization was performed on a GenePix® 4000B laser Scanner (Axon Instruments ...
-
bioRxiv - Developmental Biology 2019Quote: ... RNA purity was determined by Agilent 2100 Bioanalyser (RNA 6000 Pico Kit, Agilent Technologies).
-
bioRxiv - Physiology 2020Quote: ... using RNA 6000 Pico LabChip kits (Agilent Technologies). The RNA was separated according to fragment size and the RNA integrity number (RIN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and barcode adapters kits (Agilent, Santa Clara, USA). Library quality and DNA concentration was measured on an Agilent 2200 TapeStation using D1000 DNA tapes (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... Library construction (Agilent SureSelect Human All Exon kit), quality assessment ...
-
bioRxiv - Genomics 2019Quote: ... using the RNA Nano-chip kit (Agilent, UK).
-
bioRxiv - Genomics 2019Quote: ... SureSelectXT Human all exon V6 kit (Agilent Technologies) was used to capture exons ...
-
bioRxiv - Cell Biology 2019Quote: ... The QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) was used to generate the PP1β phosphatase “dead” mutant (harbouring the mutations D94N and H124N ...
-
bioRxiv - Synthetic Biology 2020Quote: ... plasmids were extracted using a maxiprep kit (Agilent), their concentration was measured ...
-
bioRxiv - Genomics 2021Quote: ... DNA5000 kit (Agilent technologies, Cat. #: 5067-5588, 5589). After TapeStation analysis ...
-
bioRxiv - Genetics 2020Quote: ... QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, #210519) was used according to manufacturer’s indications.