Labshake search
Citations for Agilent :
1801 - 1850 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... with an RNA 6,000 Nano Kit (Agilent). RNA sequencing libraries were made using the TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... using Dako animal research kit (Dako #A3954) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using High Sensitivity DNA kit (Agilent Technologies). Libraries were sequenced (Read1 ...
-
bioRxiv - Microbiology 2023Quote: ... and an RNA Pico Kit (Agilent Technologies), which confirmed that no severe RNA degradation was observed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The quality of libraires was assessed by Agilent DNA 1000 kit (Agilent, Cat# 5067-1504)) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cell Biology 2023Quote: ... and a High sensitivity DNA kit (Agilent). Libraries were quantified using Colibri Library Quantification kit (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and a High sensitivity DNA kit (Agilent). Libraries were quantified using Collibri Library Quantification kit (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The QuikChange site-directed mutagenesis Kit (Stratagene) was used to generate the Aq ...
-
bioRxiv - Physiology 2024Quote: ... using the RNA 6000 Nano Kit (Agilent). For RNA-Seq and qPCR analysis ...
-
bioRxiv - Immunology 2023Quote: ... Cell Mito Stress Test Kit (Agilent Technologies). Final inhibitor concentrations in the wells were 1.5 μM oligomycin ...
-
bioRxiv - Microbiology 2024Quote: ... using DNA HS ScreenTape kit (Agilent Technologies). A 76 bp single-read DNA sequencing was performed at the Core Research Facility ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quality control for constructed library was performed by Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies) and Qubit DNA HS assay kit for qualitative and quantitative analysis ...
-
bioRxiv - Microbiology 2024Quote: ... with the DNA High Sensitivity Kit (Agilent). The DNA concentration in the samples was quantified using the Qubit 2.0 instrument ...
-
bioRxiv - Biochemistry 2024Quote: ... GeneMorph II Random Mutagenesis Kit (Agilent Technologies) was used according to manufacturer instructions except that to achieve a low mutation frequency ...
-
bioRxiv - Microbiology 2024Quote: ... or the Bioanalyzer (DNA 12000 kit, Agilent) according to the manufacturer’s guidelines.
-
bioRxiv - Neuroscience 2024Quote: ... with a High Sensitivity DNA Kit (Agilent) and a Kapa Library Quantification Kit (Kapa Biosciences).
-
bioRxiv - Genomics 2024Quote: ... with Agilent DNA 12000 Kit (Agilent Technologies).
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were purified via AMPure XP bead cleanup and quantified using a Bioanalyzer (Agilent Technologies, Santa Clara, CA). A pool consisting of an equimolar quantity of each library was sequenced as 100 bp SE reads on the Illumina HiSeq2500 platform at the University of California ...
-
bioRxiv - Genomics 2020Quote: ... and quantitative PCR was performed in triplicate using the PowerUp SYBR Green Master Mix on either an AriaMx (Agilent) or a StepOnePlus (Applied Biosystems ...
-
bioRxiv - Physiology 2019Quote: ... Final libraries were amplified for 14 cycles by PCR and the final size assessed using a 2100 bioanalyzer (Agilent) with a HS DNA chip (Agilent) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The concentration and size distribution of Hi-C library DNA after PCR amplification was determined by tapestation (Agilent Technologies), and the Hi-C libraries were sequenced on Illumina Hi-Seq 2500 or Illumina Hi-seq 4000 at 50 cycles.
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were prepared by PCR amplification (30 cycles, annealing temperature 55C) using PfuUltra II Fusion DNA polymerase (Agilent) and custom primers that were designed to anneal to a 3’ site within the EGFP gene (F ...
-
bioRxiv - Cell Biology 2019Quote: ... The relative gene abundance in the cDNA sample was examined by the quantitative PCR (qPCR) experiment on MX3000 (Agilent) using PerfeCTa SYBR green PCR mix (Quanta Bioscience) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each PCR fragment was subcloned into the EcoRV recognition site of pBluescript KS (+) vector (Stratagene, La Jolla, CA, USA) using DNA Ligation kit Ver ...
-
bioRxiv - Biochemistry 2021Quote: ... Selected residues were mutated to alanine or oppositely-charged amino acids by PfuUltra II Hotstart PCR Master Mix (Agilent). All mutated sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products were purified (AMPure XP system) and the resulting libraries were analysed for size distribution by Agilent 2100 Bioanalyzer and quantified using real-time PCR ...
-
bioRxiv - Biochemistry 2020Quote: The DNA template was amplified by the polymerase chain reaction (PCR) using Pfu high-fidelity DNA polymerase (Agilent Technologies). Each 50 μL reaction consisted of gDNA (∼27 ng ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid point mutations were generated using Pfu Ultra polymerase by Quick Change PCR mutagenesis (Agilent Technologies, Santa Clara, CA). The resulting DNA constructs and strains were verified by DNA sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... The genomic SPL7 (AT5G18830.1) coding region (translational start to stop codon) was PCR-amplified and cloned into the pBluescript SK+ vector (Stratagene/Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 73 and it was used to introduce the different point mutations in MAGI1 by mutagenesis PCR using PfuTurbo (Agilent). All the Gateway destination vectors are listed in the supplementary methods ...
-
bioRxiv - Molecular Biology 2022Quote: ... the glnA gene was amplified by PCR using the PfuUltra high-fidelity DNA polymerase AD from Agilent (CAT#600385) and the following specific primers ...
-
bioRxiv - Microbiology 2022Quote: Single-base alterations to plasmid sequences were performed using a PCR technique based on QuikChange site-directed mutagenesis (Stratagene).
-
bioRxiv - Cell Biology 2022Quote: ... Triplicate reactions were set up in Semi-skirted 96-Well PCR Plates (0.2 ml) with optical strip caps (Agilent). The PCR reactions were carried out in an AriaMx Real-time PCR System (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Cassettes and the template plasmid pM07704 were amplified by polymerase chain reaction (PCR) with Herculase II DNA polymerase (Stratagene). Marker-exchange plasmids were generated by ligation of the PCR products in α-select cells (Bioline ...
-
bioRxiv - Cell Biology 2019Quote: ... The qPCR reaction was performed using Roche’s LightCycler and Brilliant II SYBR® Green QRT-PCR Master Mix (Agilent). We analyzed enrichment for target histone modifications by amplifying unique DNA barcodes at the 3’ end ...
-
bioRxiv - Microbiology 2020Quote: ... Abundances of bacterial 16S rRNA genes were determined by quantitative PCR using Brilliant SYBR Green II Mastermix (Agilent Technologies) on a Mx3000P system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... nucleotides: 907-1550) was amplified by the use of polymerase chain reaction (PCR) and cloned into pBluescript KS+ (Stratagene) via ClaI-EcoRI sites ...
-
bioRxiv - Biochemistry 2021Quote: Mutagenic PCR was used to introduce point mutations in both PgDHAR and HsCLIC1 (Table S2) following manufacturers protocol (Stratagene). 2-5μl of the PCR product was used to transform E ...
-
bioRxiv - Genomics 2021Quote: PCR was performed from each DNA sample for four regions (ORF21, ORF34, ORF46, and ORF18) using Herculase II (Agilent). Each region was then PCR purified (GeneJet ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the AMPure XP system and resulting libraries were analysed for size distribution by Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2022Quote: ... We then PCR-amplified directly from the beads using the SureSelectXT-LI Primer Mix (Agilent Technologies, Santa Clara, CA), using the same PCR conditions described above for library preparation except with a 14-cycle parameter to increase the concentration of the capture library ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutagenesis was achieved by overlapping extension PCR using the Pfu Turbo® DNA polymerase (Stratagene, La Jolla, CA, USA). For the split luciferase experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... All the qRT-PCR reactions were run on a Stratagene Mx 3005P apparatus (Agilent Technologies, Santa Clara, CA, USA) using the 5x HOT FIREPol® EvaGreen® qPCR Supermix kit (Solis BioDyne ...
-
bioRxiv - Cell Biology 2022Quote: ... The P937R mutation (c.C2810G) was introduced in the long homology arm by PCR-mediated mutagenesis (Quik-Change Lightning, Agilent), using the following primers ...
-
bioRxiv - Immunology 2024Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina NovaSeq flow cell at VIB Nucleomics core with sequencing settings according to the recommendations of 10x Genomics ...
-
bioRxiv - Immunology 2023Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina Illumina NovaSeq 6000 flow cell ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was then exposed to a temperature gradient for 3 min in a PCR machine (Agilent SureCycler 8800), followed by 3 min at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification of pcDNA3.1-NS3-mCherry-HIS plasmid was done by using PfuUltra HotStart DNA Polymerase (Agilent, Cat #: 600390) and forward and reverse primers (table 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each deletion or mutant was produced by PCR using Pfu Ultra Ⅱ Fusion HS DNA Polymerase (Agilent Technology 600670). Vectors were transfected into T7 Express lysY Competent E ...