Labshake search
Citations for Agilent :
1001 - 1050 of 1553 citations for Mouse KIF26B shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... sections were incubated with a Horseradish peroxidase (HRP)-conjugated Goat anti-mouse secondary (Dako) for one hour at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... the pT2 5UAS hSNRNP70-eGFP plasmid was used as a template for sequential site directed mutagenesis using QuickChange II (Agilent-200523) to mutate the two nuclear localization signals (NLS ...
-
bioRxiv - Microbiology 2020Quote: Mutations were introduced into a previously described TgMLC1 allelic replacement plasmid (55) using the Quick Change site-directed mutagenesis kit (Agilent Technologies). E.coli were transformed with the mutagenized plasmids and colonies screened by colony PCR and restriction digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... of the α-peptide sequence of the lacZ gene was amplified using Pfu DNA polymerase with specific primers (AlphaFor, CAGGAAACAGCTATGAC; AlphaRev, CCATTCGCCATTCAGGCTGCGCAA) and pBluescript KS- plasmid (Agilent Technologies) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... were prepared by double-stranded plasmid mutagenesis using the primer pairs listed in Table S1 and a Quikchange Site-Directed Mutagenesis Kit (Agilent Tech.). After verification by DNA sequencing ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... Three silent mutations (in capital, gctggaGatCAgGgagcaa) were introduced in the Flag-PHF2 plasmid using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) to make it resistant to siRNA oligonucleotide PHF2#1 (Flag-PHF2*) ...
-
bioRxiv - Molecular Biology 2019Quote: ... plasmid was used and the mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies).
-
bioRxiv - Synthetic Biology 2020Quote: ... The plasmid pESC-URA-USER was generated in our lab by adding USER cassette based on the plasmid pESC-URA (#217454, Agilent Technologies) for USER cloning (Nour-Eldin et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the eight genes flanked with the same promoters and terminators were cloned into the 2μ-based high-copy plasmids pESC-URA-USER and pESC-HIS (#217451, Agilent Technologies), resulting in pESC-URA-USER harboring CYP79A2 ...
-
bioRxiv - Neuroscience 2019Quote: All rAAV constructs were generated on backbone plasmid pAAV-CMV-MCS-WPRE-hGH PolyA (modified by cloning WPRE after the MCS in pAAV-MCS, Agilent, USA). Control rAAV constructs were generated as follows ...
-
bioRxiv - Neuroscience 2020Quote: Viral particles of AAV2 were packaged in transfected 293T cells with other two plasmids: pAAV-RC and pAAV-Helper (Agilent Genomics). After harvest ...
-
bioRxiv - Biophysics 2021Quote: ... the HHAT gene was cloned into the pUC19 cloning plasmid and point mutations were introduced by QuikChange™ site-directed mutagenesis (Agilent) and then transferred into pHR-HHAT-Avi-1D4.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... A plasmid containing eight copies of this 145 bp telomeric DNA was cloned into Sure2 E.coli (Agilent Technologies Singapore Pte. Ltd) following established protocols (32) ...
-
bioRxiv - Biophysics 2021Quote: ... and E217A were cloned with primers IF733 and IF734 using QuikChange Lightning Multi Site-Directed Mutagenesis Kit to generate plasmid pIF585 (Agilent #210516). RAD51(K133R ...
-
bioRxiv - Molecular Biology 2022Quote: ... we created pcDNA3-AhR-1(LBD)-VP16 by site-directed mutagenesis of the pcDNA3-AhR-1-VP16 plasmid with the QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523). The following primer pair was used to create an L to A substitution at L363 ...
-
bioRxiv - Biochemistry 2022Quote: Deletion of the C-terminal domain and of part of h12 helix (from residue 459 to residue 598) was obtained via mutagenesis of plasmid pET5blpa-Pa-aIF5B according to the QuikChange™ site-directed mutagenesis method (Stratagene). This deletion was designed after inspection of known structures (37 ...
-
bioRxiv - Molecular Biology 2022Quote: ... E197A and D199A were introduced in the parental pcDNA5/FRT/TO-DDX39B plasmid (Galarza- Munoz et al., 2017) using QuickChange Lightning Mutagenesis Kit (Agilent Technologies). All constructs and mutations were confirmed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Point mutants for ENDOD1 and TP53 were converted from parental pLVX-Flag -IRES-ZsGreen1 plasmids using QuikChange Lightning Site-Directed Mutagenesis Kits (Stratagene, 200519). Truncations of ENDOD1 and mutations of TP53 were obtained by fusing different PCR fragments using In-Fusion cloning kit (Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD58K34A OE plasmids were generated through site-directed mutagenesis of existing CD58 ORF plasmids using the QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies) per manufacturer protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pDH15-42 were derived from the low copy number (lc) LEU2 PRT1 plasmid p5188 by site-directed mutagenesis of PRT1 using the QuickChange XL kit (Agilent Technologies) and the corresponding primers in Table S2 ...
-
bioRxiv - Biophysics 2021Quote: ... An expression construct for R80A ParB was generated by site-directed mutagenesis of the wild type expression plasmid (QuikChangeII XL, Agilent Technologies). The mutant protein was expressed and purified in the same manner as wild type ...
-
bioRxiv - Molecular Biology 2022Quote: ... pSV-S515D-AR plasmids were synthesised from the pSV-AR template using the QuikChange Lightning Multi Site-directed mutagenesis kit (Agilent Technologies). Mutations were introduced using the following primers ...
-
bioRxiv - Biochemistry 2019Quote: ... hhp1 and hhp2 mutants were created by mutagenizing pIRT2 plasmids containing hhp1+ and hhp2+ using a QuikChange site-directed mutagenesis kit (Agilent Technologies). For protein production ...
-
bioRxiv - Genomics 2021Quote: ... site-directed mutagenesis was performed targeting desired codon positions of the rplD and rplV genes on the pS10 plasmid [20] using the QuikChange Lightning kit (Agilent Technologies) and the primers indicated in Supplemental Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... All point mutations of plasmids were generated by Quick Change PCR mutagenesis using Pfu Ultra polymerase (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2022Quote: ... were generated by site directed mutagenesis on HA-NOD2 plasmid (a gift from Dana Philpott) using the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: 375W substitutions in all the primary isolates were introduced by site-directed mutagenesis in plasmids carrying Envs using a QuikChange site-directed mutagenesis kit (Stratagene Inc.) and mutagenic primers to introduce each mutation (56) ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutations G to C at positions 445 and 457 were introduced into DCP2 in plasmid pQZ145 (Zeidan et al. 2018) using primers AKV005/AKV006 and the Quick-change Site-Directed mutagenesis kit (Agilent, 200519), generating plasmid pAV008 containing dcp2-E149Q,E153Q ...
-
bioRxiv - Molecular Biology 2023Quote: ... The T94D mutation was introduced in the plasmids by PCR using the QuickChange Multi-Site Directed Mutagenesis kit (#200514 -Agilent Technologies). The sequence of the primer used to introduce the mutation T94D in the Nme1 sequence of plasmids is reported in key resources table ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mutagenesis of the HDE-like motifs and PAM sequence within donor plasmid for HDR was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). pcDNA3.1(+)-ARRDC4-1 and pcDNA3.1(+)-ADCYAP1-2 expression vectors were constructed by cloning lnc-ARRDC4-1 and lnc-ADCYAP1-2 sequences to pcDNA3.1(+ ...
-
bioRxiv - Genetics 2022Quote: ... Three Myc epitopes were then inserted before the stop codon into the three plasmids with the QuickChange Site-Directed Mutagenesis Kit (Agilent Technologies) to get SLITRK3-WT-Myc ...
-
bioRxiv - Cancer Biology 2022Quote: ... were constructed from pcDNA3.1+-C-(K)-DYK-EBP plasmids using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies, #210519) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: Substitutions D479N and D499N were introduced into the PRORP expression plasmid by site-directed mutagenesis using the QuikChange protocol (Agilent Technologies). The two variants were expressed and purified like the wild type protein (19).
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cell Biology 2024Quote: ... The S71A and S71E mutations were introduced into the pDONR221-gCDC42attb plasmid with the QuickChange II XL Site Directed Mutagenesis Kit (#200521, Agilent Technologies) with the following primers ...
-
bioRxiv - Cell Biology 2024Quote: ... The S71A mutation was introduced into the pMALc-MBP::CDC-42 plasmid with the QuickChange II XL Site directed mutagenesis kit (#200521, Agilent technologies) with the following primers ...
-
bioRxiv - Biochemistry 2024Quote: ... pT7-7 α-syn FL plasmid (a gift from Hilal Lashuel, Addgene66) was transformed into BL21-Gold (DE3) competent Escherichia coli (E. coli) cells (Agilent Technologies) according to the manufacturer’s instructions and previous methodology44 ...
-
bioRxiv - Biophysics 2024Quote: ... and the reaction was carried out as recommended by the manufacturer using amplification and subsequent digestion of template plasmid DNA with DpnI (Agilent, USA). A pMAL-c5X based plasmid that contained IntI1 fused with the maltose binding protein (MBP ...
-
bioRxiv - Microbiology 2020Quote: ... we used for western blot – a goat anti-mouse immunoglobulins HRP conjugated (P0447, Dako, Germany) or anti-rabbit (P0399 ...
-
bioRxiv - Cell Biology 2022Quote: ... Goat anti-mouse and anti-rabbit horseradish peroxidase (HRP)-conjugated antibodies were from Dako (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... UK) overnight and anti-mouse IgG alkaline phosphatase-linked secondary antibody (1:5,000; Dako, USA). Membranes were incubated with CDP-Star chemiluminescent substrate (Thermo Fisher ...
-
bioRxiv - Immunology 2019Quote: ... staining was developed with the EnVision System-HRP for mouse primary antibodies (Dako, Carpinteria, CA). Sections were counterstained with hematoxylin ...
-
bioRxiv - Genomics 2019Quote: ... and the Flex mouse anti-human CD31 antibody (clone JC70A, Dako North America, Carpinteria, CA) for 90 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies coupled with horseradish peroxidase (HRP): goat anti-mouse (Dako P0447, WB: 1/1000), goat anti-rabbit (Dako P0448 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Goat anti-mouse polyclonal antibodies conjugated with horseradish peroxidase (cat. #P0447, Agilent, Santa Clara, USA) were used as secondary antibodies.
-
bioRxiv - Immunology 2019Quote: ... Antibodies used for paraffin immunostaining were: rat anti-mouse Ki67 monoclonal antibody (MIB-5, Dako) and rabbit anti-mouse Yap1 antibody (D8H1X ...
-
bioRxiv - Neuroscience 2020Quote: Mouse brains were analyzed as free-floating sections to localize immunoreactivity for GFAP (Z0334, Dako/Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...