Labshake search
Citations for Agilent :
701 - 750 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... The samples were mounted with a fluorescent mounting medium (DakoCytomation) and visualized using either a Leica TCS SP8 (Leica ...
-
bioRxiv - Molecular Biology 2024Quote: Data analysis for cell culture EVs was done using the Spectrum Mill MS Proteomics Workbench software package v 4.2 beta (Agilent Technologies). All extracted spectra were searched against a UniProt database containing human reference proteome sequences ...
-
bioRxiv - Neuroscience 2024Quote: ... Mitochondrial respiration was measured using a Seahorse Xfe96 Analyzer (Agilent Technologies). Three baseline recordings were taken followed by three recordings after each of the following subsequent injections ...
-
bioRxiv - Neuroscience 2024Quote: ... coupled to an HPLC system (Agilent Technologies, Santa Clara, CA) with multiple reaction monitoring (MRM) ...
-
bioRxiv - Neuroscience 2024Quote: ... Mitochondrial respiration was measured using a Seahorse Xfe96 Analyzer (Agilent Technologies) and normalised to basal oxygen consumption rate ...
-
bioRxiv - Neuroscience 2024Quote: hiPSC-DANs were plated in a XF96 Polystyrene Cell Culture Microplate (Seahorse Bioscience) at 50,000 cells/ well ...
-
bioRxiv - Neuroscience 2024Quote: ... The SCFA were measured in ESI negative mode using a 6495 triple quadrupole mass spectrometer (Agilent Technologies, Santa Clara, CA) coupled to an HPLC system (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... Assay medium was prepared fresh the day of the assay using XF Base Medium (Agilent Technologies) with 10 mM Glucose (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... Supplementations with sugars (Glc – Agilent, 103577 ...
-
bioRxiv - Microbiology 2024Quote: ... Data was analysed using MassHunter (Quantitative Analysis and Qualitative Analysis 10.0, Agilent) and Excel (Microsoft).
-
bioRxiv - Cell Biology 2024Quote: ... The quality and quantity of the RNA samples were examined using the 5400 Fragment Analyzer (Agilent, M5312AA). RNA libraries were constructed utilizing the NEBNext® Ultra RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... A NovoCyte Quanteon cytometer (Agilent) was used to analyze 10,000 live cells and quantify the percentage of GFP+ cells over time.
-
bioRxiv - Microbiology 2024Quote: ... The Agilent 4200 TapeStation (Agilent Technologies, CA, USA) was used to analyze the quality and RIN-values of the RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using the miRNA 1st-Strand cDNA Synthesis Kit (Agilent Technologies) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... with ratio 260/280= 2.07 ± 0.04 and 260/230=1,73 ± 0,24) and by the RNA Integrative Number (RIN) measured with a Bioanalyzer (Agilent Technologies, USA) with values > 9.2 in testis ...
-
bioRxiv - Microbiology 2024Quote: ... Quality and quantity of the extracted RNA was assessed using Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... All antibodies used a citrate buffer epitope retrieval (DAKO, Agilent). Slides were washed in PBST to remove excess retrieval buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... All antibodies used a citrate buffer epitope retrieval (DAKO, Agilent). Slides were washed in PBST to remove excess retrieval buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quality of the samples was assessed by BioAnalyzer (2100 Bioanalyzer, Agilent Technologies) with ratio 260/280= 2.07 ± 0.04 and 260/230=1,73 ± 0,24 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.4 µL universal reverse primer (Agilent Technologies), 100 ng cDNA and H2O up to 10 µL was made for each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single-indexed QuantSeq libraries were QC-checked on a Bioanalyzer 2100 (Agilent) using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... pET30a-AlkB-D135S/L118V (20) was constructed by performing site directed mutagenesis on pET30a-AlkB-D135S using the QuikChange protocol (Agilent Technologies) and the oligos L118V_FW (GATTTCCAGCCAGATGCTTGTGTTATCAACCGCTACGCTCCT ...
-
bioRxiv - Molecular Biology 2024Quote: ... coupled to camera-based detection (AI600, Agilent technologies) was used to visualize protein bands.
-
bioRxiv - Microbiology 2024Quote: ... Eluted lipids were detected using a 6550 iFunnel QTOF LC/MS system (Agilent Technologies) with the same parameters as previously described (18) ...
-
bioRxiv - Microbiology 2024Quote: ... Lipid extracts were separated on an Agilent 1290 Infinity LC System (Agilent Technologies) using a Kinetex C 18 column (Phenomenex ...
-
bioRxiv - Microbiology 2024Quote: ... and analyzed using a NovoCyte Quanteon cytometer (Agilent). Populations of live ...
-
bioRxiv - Microbiology 2024Quote: Samples were analyzed using a NovoCyte Quanteon cytometer (Agilent). Populations were gated using SSC-H/FSC-H and SSC-A/SSC-H to identify live and single cells ...
-
bioRxiv - Microbiology 2024Quote: ... virus was UV-inactivated using a UV STRATAlinker 2400 box (Stratagene, San, Diego, CA). To block viral late gene expression ...
-
bioRxiv - Microbiology 2024Quote: ... RNA quality control and next generation RNA sequencing were performed at the Genomics Core Facility of the Institute for Research in Immunology and Cancer (IRIC, University of Montreal) using 2100 bioanalyzer (Agilent) and Illumina NextSeq 500 instrument ...
-
bioRxiv - Microbiology 2024Quote: ... to inactivate ExoS ADPRT catalytic activity following the protocol provided by Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... Second and third fragments were first cloned into a bacterial vector (“StrataClone Vector Mix amp/kan”, Agilent) before being amplified by PCR ...
-
bioRxiv - Microbiology 2024Quote: ... RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-8000 (Nanodrop Technologies) and RNA integrity was assessed using a Bioanalyzer 2100 (Agilent). A standard volume of ERCC spike-in Mix was added before starting the library preparation ...
-
bioRxiv - Cell Biology 2024Quote: ... GFAP (1:400, Dako, Carpinteria, California; AB_10013482) diluted in blocking buffer ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Microbiology 2024Quote: ... and the quality of the purified RNA was assessed with an RNA 6000 Nano Chip on a Bioanalyzer 2100 (Agilent) and by 1.2% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... QuikChange XL Site-Directed Mutagenesis (Agilent, 200517) was then used to modify L13 ...
-
bioRxiv - Microbiology 2024Quote: ... and the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies). HSV-1 C12 (HSV-C12 ...
-
bioRxiv - Microbiology 2024Quote: ... RNA quality was checked with the Agilent 2100 Expert Bioanalyzer (Agilent), and cDNA libraries were prepared from the RNA samples using the Nugen Universal Prokaryotic RNA-Seq Library Preparation Kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quality checked using a Fragment Analyzer (Agilent) and were sequenced in a NextSeq 500 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Purified RNA was quality checked using a TapeStation 4200 (Agilent), and 88 ng were used for QuantSeq 3′ mRNA-Seq library construction according to manufacturer’s instructions (Lexogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantity and size distribution of cleaned cDNA was checked using the Bioanalyzer High Sensitivity Assay (Agilent Genomics, Cat: 5067-4626). Libraries for sequencing were prepared from 600pg cDNA input using Nextera XT library preparation kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... EBV BZLF1 (BZ.1; Dako, Glostrup, Denmark), LMP2A (15F9 ...
-
bioRxiv - Microbiology 2024Quote: ... RNA quality was assessed using a Bioanalyzer (Agilent). After extraction ...
-
bioRxiv - Microbiology 2024Quote: ... Mutations to EcoFtsE was generated utilizing the QuikChange kit (Agilent Technologies), using pTD68 and pET28-sumo as templates and the primers listed in Table supplement 1 ...
-
Intratumoral Microbiome of Adenoid Cystic Carcinomas and Comparison with other Head and Neck CancersbioRxiv - Microbiology 2024Quote: ... The quality and quantity of the barcoded amplicons were assessed using an Agilent 4200 TapeStation system (Agilent) and Qubit Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... This DNA was used for bacterial transformation into XL10 Gold (Agilent, 200315) chemically competent cells according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA quality was validated using a Bioanalyzer (Agilent). Library preparation was performed at the GenomEast platform at the Institute of Genetics and Molecular and Cellular Biology (IGBMC ...
-
bioRxiv - Microbiology 2024Quote: ... Data was analysed using MassHunter (Quantitative Analysis and Qualitative Analysis 10.0, Agilent) and Excel (Microsoft) ...
-
bioRxiv - Microbiology 2024Quote: ... and additional 10 mM glutamine (Agilent, 103579).
-
bioRxiv - Microbiology 2024Quote: ... connected to a 5977B GC/MSD in electron impact (EI) mode equipped with 7693A autosampler (Agilent). The GC-MS settings were as follows ...