Labshake search
Citations for Agilent :
651 - 700 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... A NovoCyte Quanteon cytometer (Agilent) was used to analyze 10,000 live cells and quantify the percentage of GFP+ cells over time.
-
bioRxiv - Microbiology 2024Quote: ... The Agilent 4200 TapeStation (Agilent Technologies, CA, USA) was used to analyze the quality and RIN-values of the RNA ...
-
bioRxiv - Microbiology 2024Quote: ... EBV BZLF1 (BZ.1; Dako, Glostrup, Denmark), LMP2A (15F9 ...
-
bioRxiv - Microbiology 2024Quote: ... RNA quality was assessed using a Bioanalyzer (Agilent). After extraction ...
-
bioRxiv - Microbiology 2024Quote: ... RNA integrity was confirmed using a Fragment Analyzer (Agilent). Illumina sequencing was performed in NextSeq500 platform.
-
bioRxiv - Microbiology 2024Quote: ... and assessed using fragment analyzer (Agilent Technologies). The libraries were then subjected to paired end sequencing on Illumina Nextseq using Nextseq Mid Output kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... on a Fragment Analyzer Automated CE system (Agilent Technologies). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... and an RNA Standard Sensitivity Kit (Agilent Technologies, catalog number DNF-471) on a Fragment Analyzer Automated CE system (Agilent Technologies) ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... Library quantification and size estimation were performed using a Fragment Analyzer (Agilent Technologies, Inc.) electrophoresis system and the final library product was selected at 470-580bp ...
-
bioRxiv - Microbiology 2024Quote: ... and integrity was assessed using fragment analyzer (Agilent Technologies). Ribosomal RNA was removed using QIAseq FastSelect –5S/16S/23S kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... and quality was assessed with the HS NGS Fragment Kit (1–6,000bp; DNF-474, Agilent Technologies).
-
bioRxiv - Microbiology 2024Quote: ... equipped with a C18 column (Zorbax® Eclipse Plus C18, 4.6×100 mm, with a pre-column filter; Agilent, USA), and Diode Array Detector (DAD 3000 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed for all the samples using the Agilent Bioanalyzer High Sensitivity DNA assay in the 2100 expert software (Agilent). All the samples passed the initial QC with a cDNA size 700-1,500 bp.
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... followed by incubation with an anti-human CD31 monoclonal antibody (1:30, mouse anti-human; Dako, Glostrup, 0823) to stain for human endothelium ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked on a BioAnalyzer High sensitivity chip (Agilent) and a Qubit fluorometer (InVitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked on a BioAnalyzer High sensitivity chip (Agilent) and a Qubit fluorometer (InVitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then quantified using Qubit 1x dsDNA HS Assay Kit for concentration and D1000 ScreenTape (Agilent Technologies, 5067-5582) for length ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library size distributions were confirmed using the High Sensitivity DNA Kit (Agilent #5067-4626) on an Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: ... Quality and quantity of the extracted RNA was assessed using Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... All antibodies used a citrate buffer epitope retrieval (DAKO, Agilent). Slides were washed in PBST to remove excess retrieval buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... All antibodies used a citrate buffer epitope retrieval (DAKO, Agilent). Slides were washed in PBST to remove excess retrieval buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quality of the samples was assessed by BioAnalyzer (2100 Bioanalyzer, Agilent Technologies) with ratio 260/280= 2.07 ± 0.04 and 260/230=1,73 ± 0,24 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.4 µL universal reverse primer (Agilent Technologies), 100 ng cDNA and H2O up to 10 µL was made for each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single-indexed QuantSeq libraries were QC-checked on a Bioanalyzer 2100 (Agilent) using a High Sensitivity DNA Kit for correct insert size and quantified using Qubit dsDNA HS Assay (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... pET30a-AlkB-D135S/L118V (20) was constructed by performing site directed mutagenesis on pET30a-AlkB-D135S using the QuikChange protocol (Agilent Technologies) and the oligos L118V_FW (GATTTCCAGCCAGATGCTTGTGTTATCAACCGCTACGCTCCT ...
-
bioRxiv - Molecular Biology 2024Quote: ... coupled to camera-based detection (AI600, Agilent technologies) was used to visualize protein bands.
-
bioRxiv - Cell Biology 2024Quote: ... Digested peptides were separated using a 50 cm reversed-phase column packed in-house (Agilent Poroshell EC-C18, 2.7 µm, 50cm x 75 µm) and eluted from the column at a flow rate of 300 nL/min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The digestion was quenched with 10% formic acid (FA) and the resulting peptides were cleaned-up in an automated fashion using the AssayMap Bravo platform (Agilent Technologies) with a corresponding AssayMap C18 reverse-phase column ...
-
bioRxiv - Developmental Biology 2024Quote: ... Post cDNA amplification and post-library construction quality control was performed using the Agilent Bioanalyzer High Sensitivity kit (Agilent 5067–4626). Libraries were sequenced using a NovaSeq 6000 and the S2 flow cell ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... Cholesterol and its deuterated standard were separated on an Eclipse Plus C8 column (Agilent), and peaks were integrated with TraceFinder 5.1 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2100 BioAnalyzer D1000 kit (Agilent 50671504) and Illumina MiSeq Nano v2 QC.
-
bioRxiv - Microbiology 2024Quote: ... RNA quality control and next generation RNA sequencing were performed at the Genomics Core Facility of the Institute for Research in Immunology and Cancer (IRIC, University of Montreal) using 2100 bioanalyzer (Agilent) and Illumina NextSeq 500 instrument ...
-
bioRxiv - Microbiology 2024Quote: ... to inactivate ExoS ADPRT catalytic activity following the protocol provided by Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... Second and third fragments were first cloned into a bacterial vector (“StrataClone Vector Mix amp/kan”, Agilent) before being amplified by PCR ...
-
bioRxiv - Microbiology 2024Quote: ... RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-8000 (Nanodrop Technologies) and RNA integrity was assessed using a Bioanalyzer 2100 (Agilent). A standard volume of ERCC spike-in Mix was added before starting the library preparation ...
-
bioRxiv - Cell Biology 2024Quote: ... GFAP (1:400, Dako, Carpinteria, California; AB_10013482) diluted in blocking buffer ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using the miRNA 1st-Strand cDNA Synthesis Kit (Agilent Technologies) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... with ratio 260/280= 2.07 ± 0.04 and 260/230=1,73 ± 0,24) and by the RNA Integrative Number (RIN) measured with a Bioanalyzer (Agilent Technologies, USA) with values > 9.2 in testis ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA Integrity Number (RIN) for all samples was 10 as assessed by an RNA Nano Kit (Agilent #5067-1511) on an Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Separations were performed on a HILIC-Z column (150 × 2.1 mm, 2.7 µm; Agilent Technologies). The mobile phase was composed of 20 mM ammonium formate + 0.25% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... and AffinityScript reverse transcriptase (Agilent). cDNA products were diluted in water (1:5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... LC-MS analysis was performed using an Agilent 1290 Infinity LC (Agilent Technologies, Santa Clara, CA) equipped with a Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and TapeStation High Sensitivity RNA ScreenTape Analysis (Agilent, 5067-5579). Libraries were pooled in equal quantity and sequenced using Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then washed with PBS and stored at 4°C in Mounting medium (Dako).
-
bioRxiv - Neuroscience 2024Quote: ... and the RNA 6000 Pico Assay (Agilent Technologies). Libraries were constructed using the KAPA mRNA HyperPrep Kit (Roche Sequencing and Life Science) ...
-
bioRxiv - Neuroscience 2024Quote: ... The quality and concentration of the libraries were assessed using the D5000 ScreenTape (Agilent Technologies) and Qubit dsDNA HS Assay (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and peak size was analyzed by Agilent 2100-H ...
-
bioRxiv - Molecular Biology 2024Quote: ... The size and quality of each library were evaluated by Bioanalyzer 2100 (Agilent Technologies). All RNA-seq libraries are sequenced on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Neuroscience 2024Quote: ... Astrocyte RNA integrity was analyzed using the 2100 Bioanalyzer (Agilent) with the RNA Pico chip ...