Labshake search
Citations for Agilent :
5151 - 5200 of 5601 citations for Rat CD178 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... All STIM1 variants were generated from the wild-type (WT) construct by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Massy, France). All resulting plasmids were checked by Sanger sequencing.
-
bioRxiv - Evolutionary Biology 2019Quote: ... cDNA library quality was quantified by a 2100 Bioanalyzer using an Agilent High Sensitivity DNA Kit (#5067-4626, Agilent, Santa Clara, CA). Barcoded libraries were pooled and underwent 75 bp single-end sequencing on an Illumina NextSeq 500.
-
bioRxiv - Cell Biology 2020Quote: ... A 0.2 µg of total RNA was subjected to Cy3 labeling by in vitro transcription with use of Low Input Quick-Amp Labeling kit (Agilent Technologies, USA). Subsequently ...
-
bioRxiv - Genetics 2019Quote: ... The site-directed mutagenesis was used to generate the constructs containing the other allele not amplified from initial cloning with the Quick Change II Site-Directed Mutagenesis Kit (Agilent Technology, USA). All the constructed plasmids were validated by sequencing and did not contain any other sequence variations ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA quality and quantity were inspected on the Agilent 2100 Bioanalyzer using the Agilent RNA 6000 Pico kit (Agilent Technologies, Inc, Germany).
-
bioRxiv - Evolutionary Biology 2020Quote: ... We assessed the RNA integrity using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). We constructed the cDNA library using NEBNext®Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... and library quality was assessed using the Agilent High Sensitivity DNA Kit (Cat.No. 5067-4626) on the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Whole-exome sequencing libraries were prepared using SureSelectXT Human All Exon V5 + UTR kit (75 Mb; Agilent technologies, Santa Clara, CA, USA) as per manufacturer’s instructions and sequenced on HiSeq 2000 to generate paired end 2 × 100bp sequence reads (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... was derived from pcDNA-V5-hWls (EVI/WLS-V5, Belenkaya et al, 2008) using the QuikChange II Site-Directed Mutagenesis Kits (200523, Agilent Technologies Inc.) according to the manufacturer’s instructions and the primers CGGAACATCAGTGGGAGGCAGTCCAGCCTGCCAGCTATGAGCAGAGTCCGGCGGC and GCCGCCGGACTCTGCTCATAGCTGGCAGGCTGGACTGCCTCCCACTGATGTTCCG ...
-
bioRxiv - Microbiology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies; Santa Clara, CA, USA). RNA sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Immunology 2021Quote: ... and quality control was performed on the Agilent 2100 Bioanalyzer with the High Sensitivity DNA Kit (Cat. No. 5067-4626; Agilent, Waldbronn, Germany). Mixed libraries were sequenced on a NextSeq550 with 2 × 75 bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... and RNA integrity was determined with an RNA ScreenTape Kit on the TapeStation 2200 system (Agilent, 5067-5576, 5067-5578, 5067-5577). cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... The purity and content of total RNA were quantified using Bioanalyzer 2100 Spectrophotometers and RNA 1000 Nano LabChip Kit (Agilent, CA, USA). Total RNA was used for subsequent experiments if the total RNA samples met the following criteria ...
-
bioRxiv - Biochemistry 2022Quote: ... The phPAI-1 library was generated by error prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) with primers that maintain the AscI and NotI restriction sites (SI Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Library preparation and sequencing were performed by Novogene Co ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Cancer Biology 2022Quote: ... The size of the collected DNA fragments was determined using a 2100 Bioanalyzer and the High Sensitivity DNA Kit (Agilent Technologies, Inc.). Libraries were run in the Rapid Run flow cell and sequenced with paired-end sequencing (2×76 bp ...
-
bioRxiv - Cancer Biology 2024Quote: Quantification of glycolytic and mitochondrial ATP production was performed using the Seahorse XFe Real-Time ATP Rate Assay Kit (Agilent, #103591-100). Prior to cell adhesion ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA quality was determined by measuring the RNA integrity number (RIN) via the High Sensitive RNA Screen Tape Analysis kit (Agilent Technologies #5067) on the TapeStation system (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... were used for each replicate and placed into 100 μL of lysis buffer + β-mercaptoethanol from the Absolutely RNA Microprep kit (Agilent Technologies). Each genotype was prepared in quadruplicate ...
-
bioRxiv - Physiology 2022Quote: ... extracellular acidification rate (ECAR) and other bioenergetic parameters were measured using the Agilent Seahorse XFp Mito stress test kit (Agilent, 103010-100). Baseline and stressed OCR and ECAR were determined prior and post-injection of stressor compounds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Slides were then treated with biotinylated secondary antibodies and target staining was performed with peroxidase-conjugated streptavidin and DAB chromogen (Dako REAL Detection System Peroxidase/DAB+, Rabbit/Mouse Kit; Dako, Glostrup, Denmark). Mayer’s hematoxylin (Carl Roth ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutation of the highly cross-species conserved miR-483-3p seed target sequence from AGGAGUG to AGGAACG (mouse) was performed using the QuickChange Site-Directed Mutagenesis kit (Agilent Technologies – 200518). The HEK-293 cells were used for miR-483-3p expression studies ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA library quality and quantity were determined using an Agilent 2100 bioanalyzer using the High Sensitivity DNA Reagents kit (Agilent, 5607-4626) and then sequenced on an Illumina NovaSeq 6000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Drug was then washed out and 1x105 cells plated in 5 replicate wells for immediate analysis using the Mito Stress Test Kit (Agilent, 103015-100) according to the manufacturer’s instructions and using the following drug concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... The integrity of RNA was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). After the fragmentation was carried out ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Probes produced from PCR templates were radiolabelled with [α-32P]-dCTP (Hartmann Analytic, #SRP-305) using Prime-it II Random Primer Labelling kit (Agilent, #300385) and oligonucleotides used as a probe were radiolabelled with [γ-32P]-ATP (Hartmann analytic #SRP-501) ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA-encoding genomic loci were amplified from up to 400 µg gDNA via PCR using a Herculase II Fusion Polymerase PCR kit (Agilent, Cat. #600677). Pooled reaction products from each treatment group were uniquely barcoded in a subsequent PCR reaction followed by electrophoresis on 2% TBE-agarose gel at 120 V ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA integrity and quantitation was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA was checked pre and post poly(A)tail addition using an Agilent RNA 6000 Nano kit run on a 2100 BioAnalyser (Agilent Technologies, USA) (Fig ...
-
bioRxiv - Physiology 2024Quote: ... Library quality assessment was performed twice during the library generation protocol with the Agilent Bioanalyzer High Sensitivity dsDNA kit (Agilent; 5067-4626). Completed libraries were quantified with both the Qubit high sensitivity dsDNA kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Measurements of aerobic respiration and glycolysis were conducted with the Seahorse Bioscience XFe96 bioanalyzer using the seahorse XF Mito Stress Test Kit (Agilent #103015-100) and the Seahorse XF Real-Time ATP Rate Assay Kit (Agilent #103592-100) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The fragment size of the libraries was assessed using the Agilent Bioanalyzer 2100 with the High Sensitivity DNA kit (Agilent, 5067-4626). The concentration of the libraries was measured by the High Sensitivity QuBit kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final sequencing libraries were quantified using a Qbit DNA HS kit (Thermo #Q32856) for concentration and a Bioanalayzer HS DNA chip (Agilent #5067-4626) for amplicon size ...
-
bioRxiv - Molecular Biology 2024Quote: All mutants were generated by site-directed mutagenesis with the QuikChange XL II site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA), as previously described (33).
-
bioRxiv - Developmental Biology 2023Quote: ... The quality and quantity of the amplified sequencing libraries were validated using a Fragment Analyzer SS NGS Fragment Kit (1–6000 bp) (Agilent, Waldbronn, Germany). The equimolar pool of samples was spiked into a NovaSeq6000 run targeting 20M reads per sample on a S1 FlowCell (Novaseq S1 Reagent Kit ...
-
bioRxiv - Cell Biology 2023Quote: pLV-CMV-IRIS-PURO-c-Src-mScarlet plasmid was used to the generation of Y527F and Y527F/K295R mutants via QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200523) according to manufacturer’s protocol using the primers listed in Table 1.
-
bioRxiv - Molecular Biology 2023Quote: ... Total amounts and integrity of RNA were assessed using the RNANano 6000Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Three independent biological replicates were performed ...
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... the RNA integrity number was 10 as assessed by the Stanford Protein and Nucleic Acid (PAN) Biotechnology Facility using the RNA Nano Kit (Agilent #5067-1511) on an Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2023Quote: ... USA) was used to check the purity (RNA Nano 6000 Assay Kit of the Bio-analyser 2100 system (Agilent Technologies, CA, USA) was used to detect the RNA integrity and assess quantitation.
-
bioRxiv - Immunology 2023Quote: ... Library quality and fragment size distribution were assessed by High Sensitivity DNA ScreenTape assay D1000 kit (Agilent Technologies, Santa Clara, CA, USA), and the concentration was determined using a Qubit fluorometer (LifeTechnologies ...
-
bioRxiv - Neuroscience 2023Quote: ... targeted mutagenesis was performed on the cloned WT p38γ by using the Quick-Change Lightning site-directed mutagenesis kit (Agilent Technologies; 210518) to create the kinase dead mutant.
-
bioRxiv - Neuroscience 2022Quote: ... RNA quantification and integrity were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). mRNA was purified using poly-T oligo-attached magnetic beads ...
-
bioRxiv - Genetics 2023Quote: Exome enrichment was applied to the cDNA purified from the previous step by using probe kit SSELXT Human All Exon V8 (Agilent, 5191-6879) for human samples ...
-
bioRxiv - Physiology 2023Quote: ... Mutations were introduced by PCR-based site-directed mutagenesis method using the Quick Change II XL Site-Directed Mutagenesis Kit (Agilent Technologies, USA) and verified by sequencing (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2023Quote: ... The integrity of RNA was assessed by 1% agarose gel electrophoresis and integrity was validated by running the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, USA). A total of 1 μg RNA per sample was used as input material to generate the RNA-sequencing library using the Illumina NEBNext® UltraTM RNA Library Prep Kit following the manufacturer’s protocol ...