Labshake search
Citations for Agilent :
5051 - 5100 of 6584 citations for Human Short Coiled Coil Protein SCOC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The fragment size estimation of the resulting libraries was assessed with High SensitivityTM HS DNA kit runed on 2100 Bioanalyzer (Agilent) and quantified using the QubitTM dsDNA High Sensitivity HS assay (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2020Quote: The deletion construct containing the catalytic domain and the interdomain linker (CreCat, residues 127-343) was prepared using QuikChange Site-Directed Mutagenesis Kit (Agilent) from a pET21A vector (Novagen ...
-
bioRxiv - Cell Biology 2020Quote: ... The OCR was then measured with an XF24 Extracellular Flux Analyzer via the XF Cell Mito Stress Kit (Agilent Seahorse). Following 5 measurements of basal OCR ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Biochemistry 2022Quote: ... according to the construct used by the Xia lab [48] was generated by the restriction free cloning method [54] and site-directed mutagenesis (QuickChange Site-Directed Mutagenesis Kit, Agilent). Expression and purification were carried out as described in Tang and Xia [48].
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glycolytic and mitochondrial ATP production rates were determined according to the XF Real-Time ATP Rate Assay Kit protocol (Agilent). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA quality control was performed using a fragment analyser and standard or high-sensitivity RNA analysis kits (Labgene ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The rRNA-depleted RNAs were converted to paired end libraries using Sure Select Strand Specific RNA Kit (Agilent Technologies, USA) or TruSeq RNA Library Prep Kit v2 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The vector used for BAF A12T expression was obtained by mutagenesis of the BAF WT expression vector using the Quikchange Site-Directed Mutagenesis kit (Agilent). The lamin A/C Ig-fold construct codes for a GST tag ...
-
bioRxiv - Biochemistry 2022Quote: YedK mutants (C2A, C2A/E105Q, N75A, E105A, E105D, E105Q, H160A) were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent). The forward and reverse mutagenic extension reactions were performed separately to improve primer annealing ...
-
bioRxiv - Biochemistry 2022Quote: ... and 500 ng of DNAse I-treated total RNA used in enzyme-plus and enzyme-minus reverse transcriptions using the AffinityScript qPCR cDNA Synthesis Kit (Agilent) with oligo(dT ...
-
bioRxiv - Biochemistry 2022Quote: ... All site-directed mutagenesis was performed on this codon-optimized spike clone as the WT form using the QuikChange II Site-directed mutagenesis kit (Agilent), following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Oxygen consumption rate (OCR) and extracellular acidification (ECAR) were measured using the Seahorse XF Cell Energy Phenotype Test Kit (Agilent). 12 × 103 cells per well were reverse transfected with siRNA control or targeting SORD in a Seahorse XF24 Cell Culture Microplate (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... The average size of the libraries was determined utilizing Agilent 2100 Bioanalyzer and High Sensitivity DNA Kit (Agilent Technologies, USA), while concentration was assessed using Qubit Fluorometer and dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and exonic splicing elements (ΔESE2 and ΔESS3) in IL7R exon 6 were introduced using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (catalog no ...
-
bioRxiv - Immunology 2022Quote: ... Mutations were introduced into VRC7480 either by site-directed mutagenesis using the QuikChange Lightning Site- Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Plant Biology 2022Quote: ... Size profile of the extracted DNA was checked using Femtopulse system genomic DNA 165 kb kit (Agilent Technologies, CA, USA). Eight HiFi SMRTbell® libraries were prepared using the SMRTbell™ Express Template Prep Kit 2.0 according to the manufacturer’s instructions (Pacific Biosciences protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... to remove larger DNA fragments and primer dimers and quality was assessed by Bioanalyzer (Agilent 2100, High Sensitivity DNA kit). Samples were pooled according to indexes for Illumina sequencing.
-
bioRxiv - Pathology 2022Quote: ... The quality and quantity of the RNA samples were analyzed using Agilent 2100 Bioanalyzer with RNA 6000 pico kit (Agilent). Bulk-mRNA sequencing was carried out with these products.
-
bioRxiv - Molecular Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Genomics 2022Quote: ... The library was amplified using 8 PCR cycles and verified on a Fragment Analyzer using the HS NGS fragment kit (Agilent). The library was quantified by qPCR using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Genomics 2022Quote: ... as measured on a 4150 Tapestation System using a High Sensitivity RNA ScreenTape Assay kit (5067-5579/5580, Agilent Technologies), were greater than 8 ...
-
bioRxiv - Microbiology 2022Quote: ... A plasmid encoding inactive RHDV2 3CLpro was generated by substituting the nucleophilic Cys with Ala in the active site of 3CLpro in pcDNA3-RHDV2 using site-directed mutagenesis (Agilent’s Quik Change mutagenesis kit, Agilent, CA) and designated as pcDNA3-RHDV2-m3CLpro ...
-
Metabolic switching and cell wall remodelling of Mycobacterium tuberculosis during bone tuberculosisbioRxiv - Microbiology 2022Quote: ... 1.0 μg of labelled cRNA from each sample and control were used for co-hybridization using the gene expression hybridization kit (Agilent) as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Mutations to delete the αCT11 region (RPRPDDLEI) of GJA1-20k and GJA1-WT was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity and quantification were assessed using the RNA Nano 6000 Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA). RNA sequencing was performed by Novogene (https://en.novogene.com ...
-
bioRxiv - Biochemistry 2022Quote: Point mutation SUR1-K134A was introduced into hamster SUR1 cDNA in pECE using the QuikChange site-directed mutagenesis kit (Stratagene). Mutation was confirmed by DNA sequencing ...
-
Secretin receptor as a target in gastrointestinal cancer: expression analysis and ligand developmentbioRxiv - Cancer Biology 2022Quote: ... The brown staining was then generated by incubation of the sections with Liquid DAB+ Substrate Chromogene Kit (Dako, Glostrup, Denmark) for 2 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pCS2HA-HA-LIX1 plasmid was used as template to generate the LIX1 variants in which cysteine 83 and 84 were substituted by serine residues with the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol and the primers listed in supplemental Table S1.
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...
-
bioRxiv - Biophysics 2022Quote: ... The insertion of an amber codon (TAG) between E715 and V716 in mGluR2 (azi-ECL2) was performed using the QuikChange site-directed mutagenesis kit (Agilent). SNAP-mGluR2 constructs used for calcium imaging had C-terminal FLAG-tag removed by PCR-based deletion using phosphorylated primers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Gα subunit plasmids were purchased from cdna.org (Bloomsburg University, Bloomsburg, PA. 4A insertion mutations were introduced to Gα subunits using the QuikChange Mutagenesis Kit (Agilent Technologies) and oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... The quality and size distribution of the DNA was assessed on a Fragment Analyzer using the HS NGS Fragment Kit (Agilent). The pooled samples were then sequenced on a NovaSeq6000 (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and Pyrrhocoris apterus samples with the Agilent RNA 6000 Pico Kit on a BioAnalyzer 2100 (Agilent, Santa Clara, United States). T ...
-
bioRxiv - Neuroscience 2021Quote: ... GlyT2 was subcloned into pcDNA3 and the GlyT2 mutants were constructed by site-directed mutagenesis using the QuikChange kit (Stratagene). Plasmids from two independent Escherichia coli colonies were transfected into eukaryotic cells and [3H]glycine transport was measured in the cells for verification ...
-
bioRxiv - Neuroscience 2021Quote: The fragment size of ChIP-seq and RNA-seq libraries was measured using high sensitivity DNA analysis kit (5067-4626, Agilent) on a TapeStation system (2200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina and verified using the Bioanalyzer RNA Nano Assay (Agilent) before sequencing on the NextSeq 500 (Illumina) ...
-
bioRxiv - Plant Biology 2021Quote: ... Both RNA quality and concentration were checked using Agilent RNA 6000 Nano Kit Bioanalyzer chip (Agilent Technologies, St. Clara, USA). 5 µg of the purified RNA was used in the reverse transcription reactions using the SuperScript III First-Strand Synthesis System for RT-PCR (Life Technologies Cuisinart) ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were quality checked for their size and concentration with electrophoresis using a High Sensitivity D1000 kit on a 2200 TapeStation (Agilent). Prepared samples were sequenced by the Center for Advanced Technology at the University of California ...
-
bioRxiv - Plant Biology 2021Quote: ... BsaI restriction sites were removed by site-directed mutagenesis using the “QuickChange II Kit” following the manufacturer’s instructions (Agilent Technologies). Plasmid DNA amplification was performed by heat-shock transformation into Escherichia coli DH5α cells (10min on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... Final libraries were amplified with 17 cycles of PCR and assessed on the Bioanalyzer with the High Sensitivity DNA kit (Agilent). All root tissue libraries that were sequenced comprised two biological replicates.
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Microbiology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... DNA removal was confirmed by PCR using primers OL398 and OL399 (Table 2) and RNA quality was assessed using an Agilent 2100 Bioanalyzer system with corresponding RNA 6000 Nano kit (Agilent) to confirm RNA integrity (RIN) ...
-
bioRxiv - Microbiology 2020Quote: ... and average fragment size of each sample was assessed using an Agilent 2100 Bioanalyzer system and RNA 6000 Nano kit (Agilent) prior to sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... and the pooled library was then quality checked and quantified with a Agilent Bioanalyzer 2100 using the DNA HS kit (Agilent). Sequencing of was performed using an Illumina MiSeq with a 300-cycle micro flow cell with V2 chemistry ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The quality was checked with an RNA 6000 Nano Chip on an Agilent Bioanalyzer 2100 (Kit #5067-1511, Agilent Technologies). All RIN-scores were higher than 5.4.