Labshake search
Citations for Thermo Fisher :
4801 - 4850 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... cells were fixed and permeabilized using eBioscience Intracellular Fixation & Permeabilization Buffer Set (Invitrogen, 88_8824-00) before incubation with intracellular markers ...
-
bioRxiv - Immunology 2024Quote: We used the eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set (00-5523-00, Invitrogen) to stain for transcription factors ...
-
bioRxiv - Microbiology 2024Quote: ... fixed and permeabilized with the FoxP3/Transcription Factor Staining Buffer Set (ThermoFisher 00-5523-00) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... elegans cel-miR-67 (5’ UCACAACCUCCUAGAAAGAGUAGA 3’), using INTERFERin®-HTS transfection reagent (Polyplus-transfection SA, Illkirch France) or Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific Inc.). AntimiRs were used at a final concentration of 75 nM and transfections were performed according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transfected for 48 hours with 25 pmol per well (24-well format) of miRNA mimic Pre-miR miRNA precursors (Ambion, Thermo Fisher Scientific, Waltham, MA, USA) as indicated ...
-
bioRxiv - Cell Biology 2020Quote: ... Primer sequences were UCP1: Hs00222453_m1 (pre-designed TaqMan assay, Life Technologies), PPIA ...
-
bioRxiv - Immunology 2021Quote: ... and excess oligoDT primer were removed using ExoSAP-IT express (Affymetrix) following manufacturers protocol prior to buffer exchange and volume reduction using AMpureXP SPRIselect paramagnetic beads (BeckmanCoulter ...
-
bioRxiv - Genetics 2021Quote: ... with Random Hexamer primers (S0142; Thermo Fisher Scientific, Waltham, Massachusetts, US) according to the manufacturer’s recommendation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and transcribed with cDNA synthesis kit using OligodT primers (Molecular probes). qPCR amplification was detected by SYBRGreen (2xSYBRGreen mix ...
-
bioRxiv - Microbiology 2021Quote: ... Excess primer was then removed via incubation with Exonuclease I (Thermofisher) for 1 hour at 37C ...
-
bioRxiv - Neuroscience 2021Quote: ... Using validated TaqMan primer probes for Bdnf (Thermo Scientific, Rn02531967_s1, Mm04230607_s1), Gria1 (Rn06323759_m1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using random hexamer primers and Maxima Reverse Transcriptase (from Thermo Scientific). The cDNA was diluted to a total volume of 200 μL.
-
bioRxiv - Molecular Biology 2021Quote: ... and cDNA was generated with random primers and Superscript III (Invitrogen). Second strand synthesis was conducted using dUTP instead of dTTP and RNase H (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers were bought as Assay on Demand kits from Applied Biosystems. qRT-PCR was performed using TaqMan assays (Col1a2 Mm00483888_m1 ...
-
bioRxiv - Microbiology 2019Quote: ... and reverse primers (Table. 4) using Phusion Polymerase (Thermo Scientific, USA). The PCR amplified products were run on 1.5% agarose gel and the specific amplified band was eluted using gel elution kit (GeneJET Gel Extraction Kit ...
-
bioRxiv - Biochemistry 2019Quote: ... reverse transcription was performed with specific primers (Superscript III, Life technologies). After the first stage PCR with overhang primers (Supplementary Table S2) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Primers (previously listed) were used for SYBR green qPCR (Applied Biosystems) (De Iaco et al. ...
-
bioRxiv - Immunology 2020Quote: ... SuperScript III Reverse Transcriptase and oligo d(T)16 primers (Invitrogen) were used to synthesize cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... and retrotranscribed with Oligo(dT)20 Primer (#18418020, Thermo Fisher Scientific) and Superscript III Reverse Transcriptase (#18080-093 ...
-
bioRxiv - Developmental Biology 2019Quote: ... RNA was reverse transcribed into cDNA using random primers (Life Technologies) and Superscript II Reverse Transcriptase (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... fluorescence-labeled probe were designed with Primer ExpressTM software (ThermoFisher Scientific), as described (71) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 mM EDTA) and 1 μl Exo-resistant random primers (Thermofisher), heated for 5 minutes at 98°C and then cooled down at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... 1.5 µL gDNA was amplified using 6 µM random primers (Invitrogen) and f29 DNA Polymerase (NEB ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.125 μl of each primer at 20 μM (Invitrogen, Carlsbad, CA), and 8.75 µl of PCR water (Sigma) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... random primers and the superscript II Reverse Transcriptase (Invitrogen, Life Technology). Specific primer pairs were designed with Applied Biosystems Primer Express software to amplify specific fragments between 50 and 60bp (additional file 15) ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcribed using random primers and MMLV Reverse Transcriptase (Invitrogen). Real-time RT-PCR was then performed on a LightCycler™ system (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 pmol of each primer and 1 μl Taq polymerase (Invitrogen) in a 20 μl reaction volume ...
-
bioRxiv - Systems Biology 2020Quote: The following Taqman primers were used and obtained from Applied Biosystems: ARHGEF2 (Hs01064532_m1) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesised using SuperScript III with random hexamer primers (Invitrogen). RT-qPCR was performed using Fast SYBR Green Master Mix (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 0.8μL of Xeno™ VIC™ Primer-Probe Mix (ThermoFisher Scientific), and 2μL of DNA template in a 20μL reaction ...
-
bioRxiv - Microbiology 2020Quote: ... using 0.2 µM of each primer and DreamTaq reagents (ThermoFisher Scientific) according to the manufacturer’s specifications with an annealing temperature of 60°C ...
-
bioRxiv - Microbiology 2019Quote: ... and dimer potential was analysed using Multiple Primer Analyzer (ThermoFisher, US).
-
bioRxiv - Molecular Biology 2021Quote: ... 0.4 μM loop primers and molecular grade water (Invitrogen, Carlsbad, CA). The reactions were incubated at 65°C for 60 min ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesized with SuperScript III and Oligo(dT)20 primers (Invitrogen), and qPCR performed with KAPA SYBR Fast (Kapa Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesised using SuperScript IV with random hexamer primers (Invitrogen) and qRT-PCR was performed using Fast SYBR Green Master Mix and 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was produced by using Random Primers (250 ng/μl, Invitrogen) and SuperScript II reverse transcriptase (Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... 1μg RNA was reverse transcribed using random hexamer primer (Thermofisher N8080127) and Protoscript Reverse Transcriptase enzyme (NEB M0368) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.75 µl of 0.3 µM forward and reverse primer (Invitrogen, UK) and 1.0 µl of genomic DNA ...
-
bioRxiv - Pathology 2022Quote: ... Primers and probes were ordered as commercially available kits (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and oligo-dT(18) or random-hexamer primers (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... and Oligo(dt)18 primers (Thermo Fisher Scientific, Carlsbad, CA, USA), according to the manufacture’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Gene-specific primers for Taqman assays were purchased from Life Technologies. TaqMan assays were done in triplicate ...
-
bioRxiv - Biochemistry 2022Quote: ... RNA was then hybridized with 50µM of random hexamer primer (Invitrogen) in the presence of 50mM MgCl2 for 10 min at 65°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... with random hexamer primers and the M-MLV Reverse Transcriptase (Invitrogen). Real-time quantitative PCR on cDNA was realized with the KAPA SYBR Fast qPCR kit (Sopachem ...
-
bioRxiv - Immunology 2022Quote: ... TaqMan probes and primers were purchased from Life Technologies (Table S1). Expression was normalized to Gapdh as well as expression levels of individual genes in a non-transplanted lymph node ...
-
bioRxiv - Cell Biology 2022Quote: 2.5 μL random primers (3µg μL-1) (Thermo Fisher Scientific, UK) and 2.5 μL Deoxynucleotide mix (10 mM ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using SuperScript III with random hexamer primers (Invitrogen). qRT-PCR was performed using Fast SYBR Green Master Mix (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA and remaining primers were subsequently destroyed with ExoSAP-It(Affymetrix), heat and NaOH ...
-
bioRxiv - Microbiology 2021Quote: Total RNA and random hexamer primers with SuperscriptIII reverse transcriptase (Invitrogen) using qPCR were employed to synthesize cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... with Oligo(dT)20 Primer (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was used in qPCR using PowerUp™ SYBR® Green Master Mix (Thermo Fisher Scientific ...