Labshake search
Citations for Thermo Fisher :
4651 - 4700 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Raw cells were transfected with 7ug reporter RNAs either with or without 30 pmoles of biotinylated miR-142-3p mimic or scrambled 3’ biotinylated mimic (Dharmacon) using the Neon Transfection System (Invitrogen; 1750V, 25ms, 1 pulse). At 1.5-2h post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then co-transfected with recombinant plasmid (300 ng) together with miR-544-3p mimic or negative control mimic (50 nM) using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) and Lipofectamine RNAimax (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... elegans cel-miR-67 (5’ UCACAACCUCCUAGAAAGAGUAGA 3’), using INTERFERin®-HTS transfection reagent (Polyplus-transfection SA, Illkirch France) or Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific Inc.). AntimiRs were used at a final concentration of 75 nM and transfections were performed according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Recipient SAEC were transfected with mirVana miRNA inhibitor (miRVanaTM miRNA inhibitor Negative control #1, hsa-miR-34a MH11030) (Ambion, Life Technologies, Foster City, CA) using Lipofectamine RNAimax.
-
bioRxiv - Cell Biology 2023Quote: ... Recipient SAEC were transfected with mirVana miRNA inhibitor (miRVanaTM miRNA inhibitor Negative control #1, hsa-miR-34a MH11030) (Ambion, Life Technologies, Foster City, CA) using Lipofectamine RNAimax.
-
bioRxiv - Molecular Biology 2023Quote: ... First-strand cDNA synthesis was performed on DNA-free RNA with random hexamer primers and/or (for NATs) gene-specific primers using RevertAid H Minus Reverse Transcriptase (EP0451, Thermo Fisher Scientific, Waltham, Massachusetts, US) or Superscript IV (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were cloned into pCR-TOPO (ThermoFisher) and Sanger sequenced ...
-
bioRxiv - Cell Biology 2019Quote: ... 1ul of SuperScript III RT/Platinum Taq mix (Invitrogen 55549) and 1.5µl of TaqMan assay mix ...
-
bioRxiv - Cell Biology 2019Quote: ... No-RT controls were prepared with PlatinumTaq Polymerase (Invitrogen, 100021272) and no SuperScript III RT enzyme was included ...
-
bioRxiv - Cell Biology 2020Quote: ... or DRAQ5 (1:500; 5 min; RT; Thermo Fisher Scientific).
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA reverse transcription was performed with Superscript III RT (Invitrogen) and random primers ...
-
bioRxiv - Cancer Biology 2022Quote: RT was performed using the SuperScript IV (Life Technologies #18091050) according to the manufacturer’s instructions except for the addition of 1uM Template Switch Oligo during first strand synthesis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 100 units of SuperScript III RT (Thermo Fisher Scientific) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and cDNA synthesis with Superscript IV RT system (ThermoFisher, 18091050) using random hexamers ...
-
bioRxiv - Molecular Biology 2019Quote: ... RT reaction was conducted with SuperScript III reverse transcriptase (Invitrogen), per manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... RT was performed using SuperScript III kit (Thermo Fisher Scientific) and the gene specific primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... and reverse transcribed with Superscript IV RT system (ThermoFisher, 18091050) using random hexamers.
-
bioRxiv - Neuroscience 2019Quote: ... 0.25 μL 40X TaqMan RT enzyme mix (Applied Biosystems A36107C), 2.25 μL lysate) ...
-
bioRxiv - Genetics 2019Quote: ... 0.5 μl of SuperScript III RT/Platinum Taq Mix (Invitrogen), and 1x of supplied buffer ...
-
bioRxiv - Genetics 2019Quote: ... 1 μl of SuperScript III RT/Platinum Taq Mix (Invitrogen), and 1x supplied buffer (containing 0.2 mM of each dNTP ...
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription (RT) was performed with SuperScript III (Life Technologies) and oligo (dT) ...
-
bioRxiv - Physiology 2019Quote: ... RT-qPCR was performed on a QuantStudio 7 (Applied Biosystems) using Fast Taqman mastermix and the following probes (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... RT was performed in a Veriti thermal cycler (Applied Biosystems) at 50°C for 50 min ...
-
bioRxiv - Immunology 2021Quote: ... 0.2 μL of SuperScript-III RT/Platinum Taq mix (Invitrogen), 1.0 μL of a mixture of all pooled primer assays (500 nM) ...
-
bioRxiv - Neuroscience 2020Quote: ... was reverse transcribed using the SuperScript IV RT Kit (ThermoFisher). The cDNA obtained was amplified by the following primers flanking the intron between exon 5 and 6.
-
bioRxiv - Neuroscience 2020Quote: ... and reverse transcribed using the SuperScript IV RT Kit (ThermoFisher) to obtain cDNA ...
-
bioRxiv - Bioengineering 2021Quote: All real-time RT-qPCR reagents were purchased from ThermoFisher. The TaqMan probes included ...
-
bioRxiv - Bioengineering 2020Quote: ... RT-qPCR was run on a QuantStudio 6 (Applied Biosystems) with RT at 48 °C for 30 min and 45 cycles with a denaturing step at 95 °C for 10 s followed by annealing and elongation steps at 60 °C for 45 s ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-qPCR was performed using Power SYBR Green (Applied Biosystems) on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was made with RT High Capacity kit (Applied Biosystems) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: RT-pPCR products were analyzed on a 2% Agarose (Invitrogen) gels using SYBR Safe DNA gel stain (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μl of SuperScript III RT (200 U/μl; Invitrogen), and nuclease-free dH2O to bring the final reaction volume to 70 μL ...
-
bioRxiv - Immunology 2021Quote: ... 2 μl 5X RT buffer (Thermo Fisher Scientific, Cat# EP0753); 2 μl (5 M ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNAs were synthesized using SuperScript II Reverse Transcriptase (RT) (Invitrogen) and oligo-dT primer (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 U/µl of SuperScript III RT (ThermoFisher Scientific) to the RNA samples ...
-
bioRxiv - Pathology 2022Quote: ... 1 μL of SuperScript III RT/Platinum Taq Mix (Invitrogen), and 1 × supplied buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and reverse transcription by SuperScript III RT (Invitrogen, Cat# 18080044). TaqMan Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using the Maxima H RT Kit (Invitrogen) and viral genomes relative to cellular GAPDH (BHK-21 ...
-
bioRxiv - Neuroscience 2020Quote: ... using SuperScript RT III First Strand Synthesis System(Thermo Fisher). RNA and remaining primers were subsequently destroyed with ExoSAP-It(Affymetrix) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or using the TaqMan MicroRNA RT kit (Thermo Fisher Scientific) from a miRNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-Superscript III (200 U/µl) (Cat # 18080-044, Invitrogen), random hexamer primers (cat # SO142 ...
-
bioRxiv - Microbiology 2020Quote: ... RT-RCR was performed using Phusion Polymerase (Thermo Fisher Scientific) with HF buffer and DMSO ...
-
bioRxiv - Immunology 2022Quote: ... blocked for 2 hr at RT with Elisa diluent (Invitrogen) (Ref ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was conducted using SYBR green (Thermo Fisher Scientific) with gene-specific primers designed against Bma-lec-1 and Bma-lec-2 transcripts (Supplemental Materials 1) ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription was performed using Maxima reverse transcriptase (RT; ThermoFisher) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... and Maxima H Minus RT Transcriptase (Thermo Fisher Scientific, EP0752).
-
bioRxiv - Molecular Biology 2020Quote: ... and Maxima SYBR Green RT-qPCR Master Mix (Thermo Scientific). Sequences of Caspase-3 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subjected to RT with Super Script III (Thermo Scientific), and the resulting cDNA was purified with Ampure XP (Beckman ...
-
bioRxiv - Cancer Biology 2020Quote: ... beads were washed with Maxima RT buffer (ThermoFisher, Cat: EP0753) and resuspended in reverse transcription mastermix with Maxima RT buffer ...
-
bioRxiv - Immunology 2020Quote: ... The SuperScript III RT First-Strand Synthesis system (18080051, Invitrogen) was used to reverse-transcribe 450-1,000 ng of RNA with random hexamers (48190–011 ...