Labshake search
Citations for Thermo Fisher :
5001 - 5050 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Viral cDNA was reversely transcribed using Superscript II RT kit (Invitrogen) with 2 μL viral RNA as template and random hexamer primers ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on the QuantStudio 3 (Thermo Fisher Scientific) platform and the cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... TaqPath 1-Step RT-qPCR Master Mix from ThermoFisher (cat# A15300) was used in the IDT 2019 nCoV CDC EUA assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed with a ViiA-7 system (Applied Biosystems) using SYBR Green (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCRs were performed using SYBR green master mix (Applied Biosystems) with 5ng of cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1µl of the RT SuperScriptTM III (200U/µl; Thermo Fisher). Reverse transcription was carried out in a thermocycler for 10 min at 25°C ...
-
bioRxiv - Systems Biology 2021Quote: ... cDNA was generated using SuperScript III RT Kit (Thermo Fisher Scientific). qPCR amplification was then done using the TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was converted to cDNA using RevertAid RT Kit (Thermo Scientific), with 12 μl of extracted RNA per reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.1 mL 200 U/mL Maxima H- RT (Thermo Fisher Scientific), 0.1 mL 40 U/mL RNasin (Lucigen ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-qPCR analysis was performed on StepOnePlus thermal cycler (Thermo scientific) with SYBR Select Master Mix (Thermo scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized using RevertAid RT reverse transcription kit (Thermo Fisher). Quantitative PCR reactions were conducted with the CFX384 real-time system (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... 6 µl of a RT-mix (200 ng) (Thermo Fisher Scientific), dNTP mix (2 mM each ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR was performed with Power SYBR Green assay (Applied Biosystems). Relative RNA expression was calculated using standard curve method and normalized by Gapdh.
-
bioRxiv - Zoology 2022Quote: ... 0.5 μl of SuperScript III RT/Platinum Taq Mix (Invitrogen, USA) and 100 ng of RNA template ...
-
bioRxiv - Cell Biology 2022Quote: ... using a stem-loop RT probe (Applied Biosystems, Forster City, CA).
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was reverse transcribed into cDNA using Superscript III RT (Invitrogen) and subsequently amplified using Taq polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using High Capacity cDNA RT Kit (Applied Biosystems). qPCR was performed using the 2X Fast SYBR® Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-qPCR was performed using QuantStudio with SYBR Green (Applied Biosystems). The PCR mixture contained 1 X SYBR Green buffer (BioRad) ...
-
bioRxiv - Zoology 2020Quote: ... 1 µl of SuperScript III RT/Platinum Taq Mix (Invitrogen, USA) and 20 ng of RNA template in a total reaction volume of 25 µl ...
-
bioRxiv - Zoology 2020Quote: ... 1 µl of SuperScript III RT/Platinum Taq Mix (Invitrogen, USA) and 20 ng of RNA template in 25 µl total reaction volume ...
-
bioRxiv - Systems Biology 2019Quote: ... Reverse-transcription (RT) was performed with Superscript III (Thermo Scientific, 18080044) in 20 μl reactions according to manufacturer’s procedures using 250 ng of ribosomal RNA depleted RNA and 2.5 μM random hexamers (PE_solexa_hexamer ...
-
bioRxiv - Microbiology 2021Quote: ... miRNA RT-qPCR was performed using TaqMan MicroRNA Assay (Applied Biosystems); for miR-16 ...
-
bioRxiv - Immunology 2019Quote: ... RT-qPCR data were analysed with 7500 Software v2.3 (Applied Biosystems). Ct difference was calculated by subtracting the Ct values from fixed or fixed-reversed to the Ct values from unfixed sample and plotted using GraphPad PRISM ...
-
bioRxiv - Genomics 2019Quote: ... RT was performed using Thermo Fisher SuperScript IV (Thermo Fisher Scientific) and a gene-specific primer (P7-pGL4.23c-UMI) ...
-
Cwl0971, a novel peptidoglycan hydrolase, plays pleiotropic roles in Clostridioides difficile R20291bioRxiv - Microbiology 2021Quote: ... and SYBR Green RT-qPCR kit were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2021Quote: ... using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems) and primers specific for the E gene of SARS-CoV-2 as per the diagnostic protocol recommended by the World Health Organization (Forward – ACAGGTACGTTAATAGTTAATAGCGT ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR reactions were performed on 2720 Thermal cycler (Applied Biosystems). Primer sequences used for this first amplification were ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR was conducted with SYBR green detection (Thermo Fisher Scientific) according to manufacturer’s protocol (primers listed in Table 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and RevertAid H minus RT reverse transcriptase (Thermo Scientific, Life Technologies) at 45 °C.
-
bioRxiv - Microbiology 2021Quote: ... and 2.5 μL of SuperScript III RT (200 U/μL; Invitrogen). Although the IVT standards were not polyadenylated ...
-
bioRxiv - Microbiology 2021Quote: ... and 6.25 μL of SuperScript III RT (200 U/μL; Invitrogen). RT reactions were incubated at 25.0°C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... and reverse transcribed using High-Capacity cDNA RT kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed after reverse transcription (Superscript II, Life Technologies) as described previously using SYBR Green ...
-
bioRxiv - Immunology 2021Quote: ... cDNA synthesis was carried out using RevertAid RT Kit (ThermoFisher scientific). The transcripts were amplified on the 7500 Fast Real-Time PCR System ...
-
bioRxiv - Immunology 2022Quote: ... Reverse transcription (RT) was performed using Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was converted to cDNA using SuperScript IV-RT (Invitrogen). An oligonucleotide corresponding to hilD mRNA 3′ UTR (PE1-hilD ...
-
bioRxiv - Genomics 2022Quote: ... 0.1μl 200U/ μl Maxima H-RT (Thermo Fisher Scientific, Cat. EP0751), 0.1μl 40U/μl NxGen RNase Inhibitor ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR was performed on a QuantStudio 1 (Thermo Fisher Scientific) with KOD SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Microbiology 2022Quote: ... and reverse transcribed using High-Capacity cDNA RT kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized using High-capacity cDNA RT kit (Thermofisher, 4368814) from 0.5 μg of RNA according to the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 μL 200 U/μL Maxima H-RT (Thermo Fisher Scientific), 0.1 μL 40 U/μL RNasin (Lucigen) ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was synthesized using the TaqMan microRNA RT kit (Applied Biosystems) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and SYBR Green RT-qPCR kit were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR was performed using SYBR green master mix (Applied biosystems), cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 5 min incubation at RT with DAPI (Thermo Fisher) for nucleolar staining ...
-
bioRxiv - Microbiology 2024Quote: ... followed by cDNA synthesis with Superscript IV RT (Invitrogen, Waltham, MA) and a poly-A primer (GAATCGAGCACCAGTTACGCATGCCGAAAAAAAAAAAAAAAAAAAAAMN) ...
-
bioRxiv - Neuroscience 2023Quote: ... Hs02387400_g1) were run on the StepOnePlus RT-qPCR platform (Applied Biosystems). Expression values were normalized to GAPDH.
-
bioRxiv - Genetics 2023Quote: ... The RT step was modified to utilize SuperScript II (Thermo Fisher) and a custom 5X First-Strand Buffer containing MnCl2 (250 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... RNA was reverse transcribed into cDNA using Superscript III RT (Invitrogen). The expression of various genes was quantified using Fast SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was synthesized with a HighCapacity cDNA RT Kit (Applied Biosystems) and TaqMan probes for Aim2 and Gapdh in combination with TaqMan Gene Expression Master Mix (all from Applied Biosystems).