Labshake search
Citations for Thermo Fisher :
4501 - 4550 of 10000+ citations for 6 fluorohexane 1 sulfonyl fluoride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... FPp cells were enzymatically passaged with Accutase and seeded at 1:2 ratio in 2 mL of expansion medium supplemented with 2 µM THZ onto 6-well plates that were sequentially coated first with Geltrex and then with 15 ug/mL mouse laminin (ThermoFisher, Cat. No. 23017015). Medium was replaced on Day 11 to remove THZ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were rinsed three times with 1X PBS and coated with ProLong Gold antifade mounting medium with DAPI (4’,6-diamidino-2-phenylindole, 100 ng/ml) (Life Technologies, P-36931) on slides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and lysed using 250 or 500 µl (for 12 and 6-well plates, respectively) of TRIzol™ Reagent (Invitrogen™, Catalog no. 15596018) 48 hours post transfection ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293 cells (wild-type or mS37 knock-out) were transfected in 6-well cell culture dish at 70% confluency with 2 μg plasmid using Lipofectamine 2000 (ThermoFisher scientific, Cat#11668027). Cells were collected after 72h ...
-
bioRxiv - Immunology 2022Quote: Primary T lymphocytes were isolated from lymph nodes of C57BL/6 mice using the Dynabeads™ Untouched™ mouse T cell kit (Invitrogen™) by negative selection ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Neuroscience 2024Quote: Separation of neurites and somata was achieved by differentiating and maintaining neurons on Nunc™ Polycarbonate Cell Culture Inserts for 6-well plates with a 3µm pore size (Thermo Fisher Scientific; 140642). Prior to cell plating ...
-
bioRxiv - Neuroscience 2024Quote: Collected rosettes were plated onto a polyhema-treated 6-cm Petri dish in NDMB medium containing NDM and 2% B27 w/o vitamin A (Gibco, Grand Island, NY), supplemented with 10ng/ml IGF-1 ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ T cells were isolated from spleens and lymph nodes of donor C57BL/6 and IFNγ-/- mice using the MagniSort CD4+ T cell enrichment kit (ThermoFisher, #8804-6821-74). Flow cytometry confirmed that >85% of isolated live CD4+ T cells were naïve (CD44loCD62Lhi) ...
-
bioRxiv - Immunology 2024Quote: ... followed by 40 cycles of denaturation at 95 °C for 30 sec and extension at 60 °C for 30 sec in the QuantStudio 6 system (Applied Biosystems Co., USA). At the end of PCR ...
-
bioRxiv - Immunology 2024Quote: ... followed by 40 cycles of denaturation at 95 °C for 5 sec and extension at 58 °C for 34 sec in the QuantStudio 6 system (Applied Biosystems Co., USA). At the end of PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... The spheroids were left intact for two days to form properly and at D1 the medium was exchanged with Essential 6 medium (Thermo Fisher Scientific, A1516401) supplemented with 10 μM Ri ...
-
bioRxiv - Bioengineering 2023Quote: ... SMLCs left at the bottom of 6-well plates after selective passaging were cultured in DMEM/F-12 medium (Thermo Fisher, cat# 11320074) supplemented with 10% FBS (Thermo Fisher ...
-
bioRxiv - Pathology 2023Quote: ... Assays were performed in quadruplicate in 20-µl reaction mixtures using the Applied Biosystems QuantStudio 6 Flex real-time PCR system (Thermo Fisher Scientific, USA). PCR was performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Total cDNA was obtained by reverse transcription using random hexamers pd(N)6 and M-MLV reverse transcriptase (Life Technologies, Carlsbad, CA, USA) at 42 °C for 50min ...
-
bioRxiv - Neuroscience 2023Quote: Paraffin-embedded frontal cortex tissue blocks from nondemented controls and patients with AD were cut at 6 µm using a microtome (HM340E, Thermo Fisher Scientific, USA). Coronal sections of the mouse brains were cut at 6 μm using a microtome ...
-
bioRxiv - Bioengineering 2023Quote: ... These slices were then fixed in 4’,6-diamidino-2-phenylindole (DAPI) mounting media (Fluoromount-G® with DAPI, Thermo Fisher Scientific, USA), and washed twice with PBS ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293T cells (ATCC) were cultured in 6-well tissue culture plates (CytoOne, USA Scientific) using Dulbecco’s Modified Eagle Medium (Gibco, supplemented with 10% FBS) at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... SH-SY5Y were seeded onto 6-well plates (200.000 cells/well) and transfected using the Lipofectamine 2000 reagent (Thermo Fisher Scientific, Milan, Italy) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Transfection lasted for 6 hours at 37°C and was terminated by replacing the medium with fresh 37°C Opti-MEM® (Life Technologies, ThermoFisher Scientific) supplemented with 50 μg/mL Gentamycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 25,000-50,000 cells were plated and transfection of specified constructs or empty vector (6-13 µg/nL) was performed with Lipofectamine 2000 (Thermo Fisher Scientific, 1166819) and Opti-MEM (Gipco ...
-
bioRxiv - Neuroscience 2023Quote: ... Spheroids were lifted from each microwell by pipetting medium in the well up and down with a cut P1000 pipet tip and were placed in Essential 6 medium (Thermo Fisher Scientific, A1516401) with the SMAD pathway inhibitors dorsomorphin (2.5 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then stained with 4′,6-diamidino-2-phenylindole (DAPI) to stain cell nuclei and mounted with Immu-Mount mountant (Thermo Scientific, Cat# 9990402) onto microscope slides.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tandem Mass Tag 6-plex labelling of eluted RNA-binding proteins was performed using the TMTsixplex Isobaric Mass Tagging Kit (Thermo Scientific; Rockford, IL) and analysis by liquid chromatography tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Cell Biology 2023Quote: ... using 1/10 of the volume of the culture medium and sonicated 6 x 10 sec (at 50% intensity, using a Fisher Scientific FB120 sonicator). Lysates were spun at 18 000 x g to remove cell debris ...
-
bioRxiv - Genetics 2023Quote: Stable lines of phNPCs containing pTRIPZ-mir-4707-EGFP or pTRIPZ-control were plated at 4.5x105 and 1.5x104 cells/well in Matrigel-coated 6-well and 96-well plates respectively in 1x differentiation media: Neurobasal A (Life Technologies 10888-022) with 1x Antibiotic- Antimycotic (Life Technologies 15240-062) ...
-
bioRxiv - Microbiology 2022Quote: ... and blocked for 45 min in 2% bovine serum albumin (BSA) in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Genetics 2023Quote: ... and heart from 6 wild-type crucian carp at 4-month-age were dissected for total RNA extraction using Trizol (Thermo Fisher, CA, USA). RNA quality was measured using Nanodrop 8000 (Thermo Fisher ...
-
bioRxiv - Immunology 2023Quote: ... the debris spot was generated by adding 6 μL of the solution containing the necrotic hepatocytes into an 8-well chamber slide (Nunc, Rochester, NY, USA) and drying for 2 hours in the laminar flow ...
-
bioRxiv - Immunology 2023Quote: ... We isolated CD4 T cells from pooled spleen and lymph nodes of 6-8-week-old Foxp3IRES-GFP mice using magnetic negative selection using the Dynabeads Untouched Mouse CD4 Cells Kit (ThermoFisher Scientific, cat#11415D), resting cells for at least 30 min at 4°C prior to electroporation ...
-
bioRxiv - Immunology 2023Quote: ... except for Fig 6 and Fig 7 which the recovered cells were counted by inclusion of counting beads (Accu-Check, Molecular Probes, Thermo Fisher Scientific) in the FACS sample according to manufacturer’s instructions and calculated using the equation ...
-
bioRxiv - Microbiology 2023Quote: iSLK-RGB-BAC16 cells seeded in 6-well plates at 50% confluency for 24 h were transfected with siRNAs with lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778150). The knockdown efficiency was confirmed by reverse transcription real-time quantitative PCR (RT-qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... and seeded at nine thousand cells per well into a 96 well v-bottomed ultra-low attachment plate (S-Bio MS-9096VZ) in recovery media (6 μM Y27632 (Fisher Scientific ACS-3030) in mTeSR+) ...
-
bioRxiv - Cell Biology 2023Quote: ... We seeded 150 μL of zoospores suspended in Bonner’s salts into a single well of a 6-well glass bottom plate (Fisher Scientific, Cat. No. NC0452316) and allowed the cells to settle for 10 min before gradually applying confinement by decreasing the pressure from -3 kPa to -10 kPa.
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then transferred to an ultra-low attachment 6-well culture plate to be cultured in GBO culture medium containing 50% Neurobasal (Thermo Fisher Scientific, 21103049), 50% DMEM:F12 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Magnetic bead removal and the evaluation of CAR expression on T cells by flow cytometry were performed on day 6 by staining with a goat anti-mouse F(ab’)2 antibody (Invitrogen, Carlsbad, CA, USA). CART cells were harvested and cryopreserved on day 8 for future experiments ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were seeded at a density of 106 cells/well or 8×105 cells/well in a 6-well or 96-well tissue culture plate (Nunc; Thermo Fisher Scientific), respectively ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... After incubation with the secondary antibody slices were washed three times for 6 min in PBS and mounted on microscopic slides covered with mounting dye with DAPI (Invitrogen, 00-4959-52).
-
bioRxiv - Neuroscience 2023Quote: ... Transcript levels of candidate genes were measured by qRT-PCR using cDNA with the QuantStudio 6 Flex Real-Time PCR System (Life Technologies, Darmstadt, Germany) according to the company’s guidelines.
-
bioRxiv - Molecular Biology 2023Quote: Real-time PCR was performed as reported previously (Tan et al., 2019) using the QuantStudio 6 Flex Real-Time PCR System (ABI, Thermo Fisher, Shanghai, China) and Roche LightCycler® 480 (Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Genetics 2024Quote: ... cell pellets were resuspended into PBS with 2% FBS and 1µg/ml of 4’,6-diamidino-2-phenylindol (DAPI) (Thermo Fisher Scientific, Cat#D1306) and transferred into 5 ml round bottom polystyrene flow tubes with cell strainer (Corning Life Sciences ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dissociated cells were blocked in 6% BSA and immunolabeled with anti-α3 antibody (mouse Anti-ATP1A3 xVIF 9-G10, MA3-915, Invitrogen, Thermo Fisher scientific) for 2 hours 200 times in PBS1x containing 1%BSA or at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... A total volume of 10µl per reaction was run on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems Thermo Fisher Scientific, 4485691) for 45 cycles (2 minutes at 50 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and mouse (n=6; kept on HFD for 28 weeks) livers were measured with the GeneChipTM miRNA 4.0 Array (Applied Biosystems, Foster City, US).
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from hind limb muscle of adult extensor digitorum longus (3-6 months) or newborns (P0) with TRIzol reagent (Thermo Fisher Scientific, 15596026) (41 ...
-
bioRxiv - Genetics 2024Quote: ... and TaqMan Assay probes were loaded in technical quadruplicates for qRT-PCR on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, 4485691). The ΔΔCt method was used to provide gene expression values after normalizing to the known reference gene Gapdh ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell aggregates were transferred into ultra-low attachment 6-well plates in Complete KSR EB medium (KnockOut™ SR (Life Technologies, #10828-028) 20% ...