Labshake search
Citations for Thermo Fisher :
4451 - 4500 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... At time of treatment the cells were also treated with 2μM CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen, ThermoFisher Scientific, Inc), which was used to measure apoptosis ...
-
bioRxiv - Neuroscience 2022Quote: To analyze effector caspase activity in stimulated hippocampal neurons we employed the CellEvent(tm) caspase-3/7 green detection assay (ThermoFisher Scientific) that allows analyzing activity in individual cells ...
-
bioRxiv - Neuroscience 2022Quote: ... and medium from day 3-7 is Neurobasal Plus medium (NB-Plus) supplemented with B-27 μg/mL (Thermo Fisher Scientific), GlutaMax 10 μg/mL (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: Crude protein extraction obtained as described above was electrophoresed through a slab isoelectric focusing gel (pH 3-7, Invitrogen Novex EC66452) employing freshly made cathode and anode buffers (Novex) ...
-
bioRxiv - Cell Biology 2022Quote: ... Single-axis tilts were collected from −60° to +60° at 2° increments at 7 □µm defocus on a Falcon 3 camera (Thermo Fisher) operated in linear mode at 22,000X magnification ...
-
bioRxiv - Immunology 2023Quote: ... as well as between stratified patient plasma samples (n=7) over three time points using an IL-23 Human ELISA Kit (BMS2023-3, ThermoFisher, Canada), as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Serum starved PANC-1 and MiaPaCa-2 cells were incubated with human properdin (20 µg/ml) and CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (5 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... BAL samples were then centrifuged at 3,000 g for 20 min to collect cells and ApoBDs for staining with a combination of SR-DEVD-FMK (caspase 3/7 activity detection dye, Thermo Fisher), annexin A5-V450 and TO-PRO-3 in 1× A5 binding buffer at room temperature for 10 min ...
-
bioRxiv - Immunology 2024Quote: ... and normal tissues were mechanically cut into 3-7 mm fragments and incubated in RPMI 1640 medium (Gibco™, cat. 42401042) containing 1 mg/ml Liberase TL Research Grade (Roche ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was removed by treating 8 μg of total RNA with 4 U of Turbo DNase (Invitrogen) for 45 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were electrophoresed through either 4-12% NuPAGE or 8% E-PAGE gels (Thermo Fisher Scientific, MA, USA) and transferred to nitrocellulose by iBlot 2 dry blotting system (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... the protein samples were separated on 4-20% SDS-PAGE or Bolt™ 8% Bis-Tris gels (Invitrogen) for 1 h and blotted onto PVDF membrane ...
-
bioRxiv - Cancer Biology 2019Quote: ... 8-30μg of whole-cell extract was separated on precast 4 to 12% bis tris protein gel (Invitrogen) and transferred to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions (200 μL) were incubated for 4 h in 8-well Nunc Lab-Tek chambers (Thermo Scientific #155361). Brightfield and Cy3 fluorescence images were captured on a Nikon Ti Eclipse wide-field microscope ...
-
bioRxiv - Bioengineering 2024Quote: ... and anti-acetylated tubulin staining: 4 mL blocking buffer containing 8 μL Alexa Fluor 488 (Invitrogen, A-11006), 8 μL Alexa Fluor 594 (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: MCF10A cells were from Maria Jasin (MSKCC) and cultured in 1:1 mixture of F12:DMEM media supplemented with 5% horse serum (Thermo Fisher Scientific), 2 0 n g/ml h uman E GF (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were grown in HyClone RPMI-1640 medium (15% FBS [HyClone], 1% L-Glutamine and 1% Penicillin:streptomycin [Invitrogen]; 37°C, 5% CO2). RNA was extracted with Trizol LS (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... the HUVECs’ tight junctions were stained using 5 μg/mL ZO-1 (Zonula Occludens-1) Monoclonal Antibody conjugated with Alexa Fluor 488 (Thermo Fisher Scientific) solution in previously prepared 3% BSA during O/N incubation at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown in DMEM/F12 (1:1) medium supplemented with 5% fetal bovine serum (Cytiva) and 100 U/mL penicillin/streptomycin (Thermo Fisher Scientific). All cells were grown at 37°C with 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Prepared 200X dilutions were then diluted to 2X concentration in infection media (Gibco DMEM supplemented with 5% HyClone FetalCloneII, 1% Gibco NEAA, 1% Gibco Pen-Strep). Growth media was removed and cells were pretreated with 2 X drug for 1 hour prior to infection at 37C and 5% CO2 ...
-
bioRxiv - Immunology 2019Quote: ... Real-time PCR was conducted using 1× FAM labelled Taqman® Gene MGB probes with 1-5 ng of cDNA template using 1× Taqman Universal PCR Master Mix (Applied Biosystems). Reactions and analysis were performed in a CFX-Connect Real-Time System with the following cycle conditions ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 µL cDNA (1 µg/µl) and 5 µL Power SYBR® Green-PCR Master Mix (Applied Biosystems/Life Technologies, Darmstadt, Germany): the amplification regime consisted of a 95°C/10 min denaturation step ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 µL cDNA (1 µg/µl) and 5 µL Power SYBR® Green-PCR Master Mix (Applied Biosystems/Life Technologies, Darmstadt, Germany): the amplification regime consisted of a 95°C/10 min denaturation step ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were washed 3x 5 minutes in PBST then incubated with anti-rabbit and anti-mouse antibodies (LI-COR, 1:15,000 or ThermoFisher, 1:10,000) diluted in 4% milk/PBST for 1.5 h at RT ...
-
bioRxiv - Genetics 2023Quote: ... the medium was removed and NIM was added with doxycycline plus 5 µg ml–1 puromycin and 250 µg ml–1 hygromycin B (Thermo Fisher Scientific) (NIM selection medium) ...
-
bioRxiv - Cell Biology 2023Quote: ... were originally passaged in [5 mM] glucose DMEM:F12 (1:1 mixture of F:12 [10mM] glucose and [0 mM] glucose DMEM) (Gibco, 11765054 and 11966025) supplemented with 5% Horse Serum (HS ...
-
bioRxiv - Developmental Biology 2023Quote: ... were used 1:500 in solution containing 3% NGS and 0.1% Triton X-100 in PBS at room temperature for 1 h mixed with Hoechst 33258 (5 μg/ml; Thermo Fisher Scientific) to visualize nuclei ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by passage at 1:5 or 1:10 into a new tissue culture (TC)–treated T75 flask (Thermo Scientific ref 156499). Before transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were washed by PBS with 0.1% Tween 20 (PBST) (three times for 5 min each) and incubated with Alexa Fluor secondary antibodies (1:500) (Thermofisher, #A-11036) for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... were subsequently transduced with untagged MX2 expression vectors and selected with 5 µg ml−1 blasticidin (#ant-bl-1, Thermo Fisher Scientific) for 14 days ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant fluid was loaded at 1 ml/min onto a column (1 × 5 cm) of HisPur Ni-NTA Superflow Agarose (Thermo Fisher Scientific) pre-equilibrated with buffer B lacking 0.1 mM PLP ...
-
bioRxiv - Bioengineering 2023Quote: ... Then the cells were stained with a solution of 4 mM calcein AM (TRC, #C125400) and 4 mM ethidium homodimer-1 (Thermo Fisher, #L3224) dissolved in PBS to identify live and dead cells ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with secondary antibodies in vehicle overnight at 4 °C (Alexa flor 488 goat anti mouse, Invitrogen A11001, 1:1000; Alexa flor 546 goat anti rabbit, Invitrogen A11035, 1:500). After 3 washes for 30 minutes in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... then placed on an agarose pad (4% agarose in sterile water mixed 1:1 with 10%FBS in DMEM (Gibco, Cat. No.11965), and with doxycyline (2 μg/ml)) ...