Labshake search
Citations for Thermo Fisher :
4251 - 4300 of 10000+ citations for Recombinant Human FCGRT & B2M Protein His Avi Strep II tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with fluorescence-tagged secondary antibodies (Molecular Probes Alexa series, all 1:400 in PBS) for 1h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were incubated with Alexa Fluor 555 tagged donkey-α-rabbit secondary antibody (1:1000; Molecular Probes) and Alexa Fluor 488-tagged donkey-α-goat secondary antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Biotin-tagged DNA nicks were visualized using Alexa488-or Alexa647-conjugated streptavidin (Molecular Probes, diluted 1/1000) during the incubation with the secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... The supernatant fraction containing the GST-tagged constructs were loaded onto Protino Glutathione Agarose 4B (Fisher Scientific) beads and impurities were removed by washing with TBS ...
-
bioRxiv - Cell Biology 2023Quote: MDA-MB-231 clones H2 and C10 carrying endogenously tagged HiBiT-cIAP1 were generated by Thermo Fisher and were used for compound screens ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were next incubated with AlexaFluor-555 tagged donkey-α-rabbit secondary antibody (1:1000, Molecular Probes) for one hour and imaged with a Nikon Eclipse 90i or a Nikon Eclipse Ti2 inverted microscope ...
-
bioRxiv - Neuroscience 2023Quote: ... The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... His8-tagged TGM2 was first pulled down by BSA-blocked Ni2+-NTA agarose beads (Thermo Fisher Scientific). Next ...
-
bioRxiv - Cancer Biology 2024Quote: MOLT-4 cells expressing HiBiT-tagged CDK9 were cultured in RPMI 1640 medium (Thermo Fisher Scientific, 11875093) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... PowerLoad and FluxOR II Reagent from the FluxOR II Red Potassium Ion Channel Assay kit (Thermo Fisher Scientific) and a low chloride buffer (15 mM Na-HEPES pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2013) by means of LR recombination reactions using either LR II Clonase or LR II Clonase Plus (Invitrogen). The destination vector used to generate GFP-GUS promoter reporter lines was R4L1pGWB632 ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Genetics 2024Quote: ... human for rs2297550 from ThermoFisher.
-
bioRxiv - Cell Biology 2020Quote: ... using LR Clonase II (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2021Quote: ... The Countess™ II FL (ThermoFisher Scientific) automated cell counter was then used according to manufacturer recommendations to determine the cell concentration of each of these cell suspensions ...
-
bioRxiv - Biochemistry 2021Quote: ... the Superscript™ II RT protocol (Invitrogen), the ORA qPCR Green ROX L Mix (HighQu ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 uL of Superscript II (Invitrogen, 18064014), 1 uL of nuclease free water or RNasin (Promega ...