Labshake search
Citations for Thermo Fisher :
4051 - 4100 of 10000+ citations for Recombinant Human FCGRT & B2M Protein His Avi Strep II tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng/mL recombinant RSPO1 (Thermo Fisher Scientific, cat# 120-38-500UG), and 100 ng/ml recombinant noggin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μL of 40U/μL of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, #10777-019), and 0.5μL 200 U/μL SuperScript III reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... The presence of secreted Fc Fusion protein in the medium was confirmed by immunoblotting with goat anti-human IgG antibody (Invitrogen, A-21433, 1:500).
-
bioRxiv - Immunology 2021Quote: ... was biotinylated with 20-fold molar excess of NHS-LC-LC-biotin (Thermo Fisher Scientific, Inc.) and labelled with Cy3 monoreactive dye pack (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... Biotinylated RNA was precipitated with chloroform/isopropanol and incubated with Dynabeads M-270 Streptavidin (Thermo Fisher) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Biotinylated subunits of γ-TuRC were assessed by immunoblotting with Streptavidin-conjugated alkaline phosphatase (S921, ThermoFisher). For further conjugation of Alexa-568 dye to γ-TuRC ...
-
bioRxiv - Cell Biology 2022Quote: Antibodies were biotinylated by overnight incubation at -4°C with EZ-link™ (Thermo Fisher Scientific,), at 20-fold molar excess ...
-
bioRxiv - Genomics 2020Quote: ... The 5’ end cap structure was biotinylated and captured with streptavidin-coated magnetic beads (Thermo Fisher). After ligation of 5’ and 3’ adaptors ...
-
bioRxiv - Immunology 2021Quote: ... Phage display was performed on biotinylated RBD immobilized on streptavidin magnetic beads (Dynabeads M-280, Invitrogen) or strep-tagged spike immobilized on Strep-Tactin XT magnetic beads (IBA Lifesciences) ...
-
bioRxiv - Immunology 2021Quote: ... PfAMA1 and PfMSP1 were biotinylated using EZ-link Sulfo-NHS-LC-Biotinylation kit (Thermo Fisher Scientific) and HA proteins were biotinylated using AviTag technology (Avidity ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were then incubated in biotinylated donkey anti-goat secondary antibody (1:250, Thermofisher, A21432, USA) for 60 minutes at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: 5% biotinylated dextran-conjugated tetramethyl rhodamine 3000 MW (micro ruby, #D-7162; Molecular Probes, Eugene, OR) in distilled water47 ...
-
bioRxiv - Biophysics 2022Quote: DDM-solubilized claudin-4 was biotinylated using N-hydroxysuccinimide polyethylene glycol biotin (NHS-PEG4-biotin, ThermoFisher) by mixing 5.6 μM claudin-4 with 16.8 μM NHS-PEG4-biotin ...
-
bioRxiv - Cell Biology 2021Quote: ... 100pmol biotinylated peptides (Peptide 2.0) were bound to 8μl streptavidin M-280 Dynabeads (Thermo Fisher Scientific) for 30mins in PBS at room temperature with agitation ...
-
bioRxiv - Physiology 2021Quote: ... sections were incubated in 1:200 v/v biotinylated secondary antibody solution for 30 minutes (Invitrogen), rinsed in PBS and incubated in avidin-biotin-peroxidase complex (ABC Standard ...
-
bioRxiv - Bioengineering 2021Quote: ... IgM or C1q samples were biotinylated using NHS-PEG4-biotin EZ-link kit (Thermo Fisher Scientific) and manufacturer conditions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... after which the clarified lysates containing biotinylated ERK2 and pERK2 were subjected to avidin agarose (ThermoFisher) to purify the Avi-tagged proteins according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... RBD-Fc was biotinylated with EZ‐link sulfo‐NHS‐LC‐biotin (Thermo Fisher Scientific, Waltham, MA) (RBD-Fc-Bio) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA hybridized to biotinylated-RNA baits was captured with streptavidin beads (Dynabeads MyOne Streptavidin T1, Invitrogen) and resuspended in 20µL water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA fragments hybridized to the biotinylated probes were recovered using MyOne Streptavidin C1 Dynabeads (Life Technologies). Third ...
-
bioRxiv - Immunology 2022Quote: ... All fluorescently labeled antibodies and the biotinylated spike-trimer conjugated to streptavidin-allophycocyanin (SA-APC) (Invitrogen) were titrated before sorting ...
-
bioRxiv - Immunology 2022Quote: ... Thioredoxin-fused peptides were chemically biotinylated with EZ-Link Sulfo-NHS-LC-biotin (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2022Quote: ... and purified anti-IFNγ and BsAb were biotinylated by EZ-Link Sulfo-NHS-SS-Biotin (ThermoFisher) and buffer exchanged by Zeba Spin Desalting Columns (7K MWCO ...
-
bioRxiv - Neuroscience 2021Quote: ... and with a biotinylated secondary antibody (goat anti-rabbit, Molecular Probes/Life Technologies, Grand Island, NY), before being reacted with DAB/peroxide ...
-
bioRxiv - Neuroscience 2021Quote: ... and with a biotinylated secondary antibody (goat anti-rabbit, Molecular Probes/Life Technologies, Grand Island, NY), before being reacted with DAB/peroxide ...