Labshake search
Citations for Thermo Fisher :
4351 - 4400 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and Oligo (dT) 12-18 Primer (#18418012, ThermoFisher Scientific). Separate real-time PCR (RT-PCR ...
-
bioRxiv - Immunology 2022Quote: ... The primers and probes used were from Applied Biosystems, and samples were run in duplicates on a 384-well PCR plate (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Oligo(dT)18 primer (SO131, Thermo Fisher Scientific). Quantitative PCR (qPCR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Oligonucleotide primers (Supplementary Table) were synthesized by Life Technologies. Enzyme-encoding genes were inserted into pre-assembled Gateway-compatible plasmids that contain constitutive promoters and terminators (Supplementary Table) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grem1 primer/probes were all purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... with primers and probe for ACTB (Hs01060665_g1, Applied Biosystems) and 18S rRNA (Hs99999901_s1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and random hexamer primers (ThermoFisher Scientific; see supplementary methods). We then used RT-PCR assays to reveal the viruses to which laboratory recipient females had been exposed ...
-
bioRxiv - Physiology 2023Quote: ... and qPCR was performed using TaqMan primers (ThermoFisher Scientific) for IL8 and glyceraldehyde-3-phosphate dehydrogenase in separate reactions ...
-
bioRxiv - Immunology 2023Quote: ... The primers and probe specific for hACE2 (Life Technologies) are as follows ...
-
bioRxiv - Immunology 2023Quote: ... and oligo(dT)12-18 primers (Thermo Fisher Scientific). 15 ng of cDNA was amplified using Taqman Universal PCR Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and miRNA-specific stem-loop primers (Applied Biosystems Thermofisher). Real-time quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and miRNA-specific stem-loop primers (Applied Biosystems Thermofisher). Real-time quantitative PCR (qPCR ...
-
bioRxiv - Genomics 2023Quote: ... and primed with Oligo(dT)20 primers (18418020, Invitrogen), random hexamers (48190011 ...
-
bioRxiv - Genetics 2022Quote: ... Selected TaqMan primers were: Mt1 (Mm00496660_g1, ThermoFisher, FAM-MGB); Map1b (Mm00485261_m1 ...
-
bioRxiv - Genomics 2023Quote: RNA was reverse transcribed using oligo-dT primers (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... together with genespecific primers using TaqMan Assays (Thermo Fisher). GAPDH was used as the housekeeping gene ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of forward primer (10 μM; Invitrogen, US), 1 μl of reverse primer (10 μM ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of forward primer (1.5 μM; Invitrogen, US), 10 μl of reverse primer (1.5 μM ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of reverse primer (10 μM; Invitrogen, US), 35.3 μl of nuclease-free water (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... and Taqman probes and primers for G0S2 (Thermofisher, Hs00274783_s1), ADH1C (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primer extensions were performed with SuperScript III (Invitrogen, 18080093) following standard methods.
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of reverse primer (1.5 μM; Invitrogen, US), 18 μl of nuclease-free water (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers used include Gapdh (SA Biosciences) and Cldn9 (ThermoFisher).
-
bioRxiv - Immunology 2024Quote: ... Taqman primers and probes were purchased from Applied Biosystems: Mm00439618_m1 (IL-17A) ...
-
bioRxiv - Cell Biology 2024Quote: ... and primers or pre-designed probes (Thermo Fisher Scientific) are listed in Supplementary Table 1.
-
bioRxiv - Cell Biology 2024Quote: ... and Random Hexamer Primer (all from Thermo Fisher Scientific). The mRNA expression levels were measured by quantitative RT-PCR using TaqMan assay probes (listed in Table 3. ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Random Primers (Catalog No. 48190011, Thermo Fisher Scientific). The qPCR was performed using Takyon Low ROX SYBR 2X MasterMix (Catalog No ...
-
bioRxiv - Microbiology 2024Quote: ... Primers and PowerUp SYBR Green Master Mix (Applied Biosystems) were added to the samples ...
-
bioRxiv - Immunology 2024Quote: The primer used for TaqMan are GAPDH (ThermoFisher, Mm99999915_g1), Il5 (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... using a combination of random primers (Invitrogen, cat. 48190011) and LTR-specific primers for reporter primary cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... and random primers (Thermo Fisher Scientific, Cat. No. 48190011). qPCR reactions were conducted in triplicate for each sample using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec ...
-
bioRxiv - Immunology 2024Quote: ... Taqman primers and probes were obtained from Life technologies. The housekeeping gene β2-microglobulin was used as an internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was performed using primers for RUNX1 (Hs01021970_m1; ThermoFisher) and the YWHAZ housekeeping gene (Hs03044281_g1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 μL of Oligo d(T) primer (Invitrogen, #18418020), 0.5 μL of SUPERase inhibitor (Ambion ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were made using the Platinum® SYBR® Green RT-qPCR SuperMix-UDG kit (cat. 11733046, ThermoFisher Scientific). Reactions were denatured at 95°C for 20 sec ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit; Invitrogen, Life Technologies) and random hexamer primers (50 ng ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed with Taqman assay chemistry in a 96 well format using a QuantStudio1 RT-qPCR machine (Applied Biosystems). TaqMan probes (Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by an anti-mouse secondary antibody (V5: 1 hr, RT, 1/500; Invitrogen, Cat #A21200; FLAG: 2 hr, RT, 1:200; Invitrogen, #A11004) according to the manufacturer instructions ...
-
bioRxiv - Genomics 2022Quote: ... in PBS+RI for 10 minutes at RT and blocked for 30 minutes at RT with 1% bovine serum albumin (BSA, Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: ... Then cells were permeabilised with 0.1% Triton X-100 in PBS (20’, RT) and actin cytoskeleton stained (10’, RT) with phalloidin (165nM final concentration, Thermo Fisher), prior to imaging on LSM 980 confocal laser-scanning microscope equipped with an Airyscan 2 module (Zeiss ...
-
bioRxiv - Neuroscience 2023Quote: Reverse transcription (RT) of total RNA to single-stranded cDNA was performed using the High-Capacity cDNA RT Kit (Thermo Fisher). Quantification of Kif4a expression was performed relative to the endogenous housekeeping genes Ornithine Decarboxylase (Odc ...
-
bioRxiv - Cell Biology 2020Quote: ... first the promotor region of tret1-1 was cloned from genomic DNA (forward primer: CACCGGTCTCAAGCTCTCTTTTTTGCCTTACATATTTT, reverse primer: TGGGTAAGTTGGAGAGAGAG) into the pENTR™ vector using the pENTR™/D-TOPO® Cloning Kit (Thermofisher). Via the gateway system ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2020Quote: Specific primers and probes for real-time qPCR analysis of Atlantic haddock were designed with Primer Express software (Applied Biosystems, Carlsbad, California, USA) (cyp1a and the technical reference ef1a ...
-
bioRxiv - Genomics 2022Quote: ... Viral mRNA expression was measured with HIV-1 gag primer probe mix (Supplementary Table 9) and normalized to Eukaryotic 18S rRNA Endogenous Control (VIC™/TAMRA™ probe, primer limited) (Applied Biosystems). Relative expression was calculated using the ΔΔCt method (47) ...
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...
-
bioRxiv - Physiology 2020Quote: ... Sequences from the annotated walleye reference transcriptome were used to develop primers for target genes as well as five reference genes using Primer Express v.3 (Applied Biosystems, Thermo Fisher Scientific) (Table 1) ...
-
bioRxiv - Microbiology 2024Quote: ... used for the duplex qPCR for canola blackleg detection (Fu et al. 2023) were analyzed for potential primer dimers using Multiple Primer Analyzer hosted by Thermo Fisher (https://www.thermofisher.com). One set without any predicted primer dimer was selected to be used in this study and named P-VL (Table 1) ...
-
bioRxiv - Plant Biology 2023Quote: ... Extracted DNA was used as template for PCR amplification of the v5/v6 region of 16S rRNA gene using 799F and 1193R primers (See Extended Data Table 5 for the sequence of primers) and high fidelity AccuPrime Taq DNA Polymerase (Invitrogen Cat. No. 12346086). Amplified products were run in 1% agarose gels to separate bacterial and chloroplast 16S rDNA amplicons (~400bp ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were seeded in six-well plates and transfected with miR-21-inhibitor or inhibitor-control using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following manufacturer’s instructions ...