Labshake search
Citations for Thermo Fisher :
3951 - 4000 of 10000+ citations for 6 fluorohexane 1 sulfonyl fluoride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed in a final volume of 10 μL per reaction in 384-well PCR plates using a thermocycler (QuantStudio 6 Flex, Applied Biosystems). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: Phosphor imaging of [γ-32P] radio-labelled DNA sequences was accomplished through 6% denaturing PAGE constituted of 1X TBE (89 mM Tris base, 2 mM EDTA and 89 mM boric acid, Fisher Scientific) (57) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting plasmid was used to transfect HEKR4 PTC reporter cells in 6-well plates with Lipofectamine 2000 (Invitrogen, Cat# 11668019) and PLUS™ Reagent (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... At 70-80% confluence cells were seeded into 6 well plates and were allowed to differentiate by replacing proliferation media to differentiation media [DMEM (Life Technologies) containing 2% HS (New Zealand origin ...
-
bioRxiv - Pathology 2022Quote: ... qRT–PCR was performed using qPCRBIO SyGreen Mix (Protech) and the QuantStudio™ 6 Pro Real-Time PCR System (Applied Biosystems/Thermo Fisher Scientific Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were dissociated and seeded (on coverslips inside a 6 well plate: 0.2E6 cells/well) onto plates containing NB plus [Neurobasal medium supplemented with B27 (Invitrogen GIBCO Life Technologies), GlutaMAX (GIBCO) ...
-
bioRxiv - Cancer Biology 2024Quote: ... neurons were plated at a density of 0.8x106 cells per well of 6-well plates coated with 50 ug/mL Poly-D-Lysine (Thermofisher, #A38904-01) and 1ug/mL Laminin (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... was developed over 17 min at a flow rate of 6 μl/min using an Ultimate 3000 capillary flow LC system (Thermo Scientific). Detection was performed with an ion trap mass spectrometer (Bruker amazon speed ETD ...
-
bioRxiv - Neuroscience 2022Quote: ... 3.5 cm) containing 30 larvae and a plastic-covered stirrer (magnetic stir bar micro PTFE 6 mm x 3 mm; Fisher Scientific) were placed on a magnetic stir plate (Variomag Poly 15 stirrer plate ...
-
bioRxiv - Neuroscience 2022Quote: ... the midbrain or cortical tissue from the 6-8 embryos were pooled together before digestion with Trypsin-EDTA 0.12% (Life Technologies, USA) for 7 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclear staining of glass-mounted brain sections was performed by 10 min incubation with PBS containing 2.5% DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific). Sections were embedded in mounting medium containing 1,4-diazabicyclooctane (DABCO ...
-
bioRxiv - Neuroscience 2022Quote: ... On day 6 in suspension the organoids were transferred to neural medium containing Neurobasal™-A Medium (Thermo Fisher Scientific, 10888022), B-27™ Supplement ...
-
bioRxiv - Molecular Biology 2022Quote: 100,000 LX2 or 20,000 RAW cells were seeded in 6- and 12-well tissue culture plates and allowed to grow for 24h in DMEM (GIBCO, Life Technologies) containing 10% FBS and antibiotics ...
-
bioRxiv - Neuroscience 2022Quote: ... along with a minus reverse transcriptase control (-RT) were ran for each gene on the QuantSudio 6 Flex Real-Time PCR System (Applied Biosystems). The -RT served as a negative control ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µg of plasmid and 6 µg of PEI were diluted in 0.5 mL of Opti-MEM™ Reduced serum medium (Gibco™) per single well ...
-
bioRxiv - Immunology 2022Quote: ... 100 μg of HDM or OVA were reconstituted in PBS with 0.1 M sodium bicarbonate at 1 mg/ml and mixed with 18 μg Texas Red-succinimidyl ester or 36 μg 5,(6)-TAMRA-succinimidyl ester (Life Technologies), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR (RT-qPCR) was performed using the PerfeCTa SYBR green fastmix (Quantabio) on a QuantStudio 6 Flex real-time PCR instrument (Applied Biosystems). Normalized gene expression was calculated by comparative threshold cycle method using Actb as the endogenous housekeeping gene control ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Syber green-based qPCR was performed using primer sets (Table S1) with 50 ng of cDNA from each sample in the QuanStudio-6 qPCR system (Applied Biosystems) with thermocycle condition ...
-
bioRxiv - Bioengineering 2022Quote: ... The carotid arteries were then washed with HEPES-PSS and submaximally constricted 10-15% using 10−6 M phenylephrine (207240100; Acros Organics). Vasodilation was measured by treating carotid arteries for five minutes with RBC-EVs isolated using exoEasy ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... Neuro-2a cells were cultured on 6-well plates and then transfected with a total of 2 µg of an expression plasmid using Lipofectamine 2000 (Invitrogen, USA) as per the instructions provided by the manufacturer.
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eµ-Myc lymphoma cells grown in 6-well plates were spiked with 20 µM O-propargyl-puromycin (Thermo Fisher Scientific, C10459) for the final 30 min of the experimental period ...
-
bioRxiv - Biochemistry 2023Quote: 1.3 million HEK293T cells were seeded in a 6 cm dish in 5 ml of DMEM [high glucose DMEM (Gibco, 12800), 3.7 g/L NaHCO3 ...
-
bioRxiv - Biochemistry 2024Quote: ... ExpiCHO-S cells were grown to a density of 6 x 106 cells/mL and transfected using the ExpiFectamine CHO Transfection Kit (ThermoFisher Scientific) and expression carried out for 7-10 days post-transfection at 37°C with 8% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... E0771 cells were harvested by trypsinization and cultured at a density of 106 cells/well in 6-well NunclonTM SpheraTM low-adhesion plates (ThermoFisher, 174932) to prevent substrate attachment ...
-
bioRxiv - Bioengineering 2024Quote: ... iPSCs with the initial passage number of 24 were cultured in a 6-well plate coated with 0.5 mg Matrigel™ (354230, Fisher Scientific) in complete mTeSR plus medium (100-0276 ...
-
bioRxiv - Immunology 2023Quote: ... All samples were assayed using the 7300HT or QuantStudio 6 Fast Real-Time PCR System and analyzed using Fast System Software (Applied Biosystems). All real-time PCR data was normalized to the level of GAPDH mRNA ...
-
bioRxiv - Bioengineering 2024Quote: A volume of 4 μl of Cy5-labeled DO structures at 50 nM concentration were mixed with 6 μl R Buffer solution (Neon kits-MPK1096 Thermo Fisher). DO structures in R buffer were then immediately subjected to electroporation using the Neon Transfection system (MPK5000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the tissue specimens were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted in VECTASHIELD Vibrance Antifade Mounting Medium (ThermoFisher Scientific). Akoya Biosciences’ PhenoImager HT (formerly known as Vectra Polaris Automated Quantitative Pathology Imaging System ...
-
bioRxiv - Cell Biology 2024Quote: ... Transfections were performed with 10 nM of siRNA sequences (6-well plates) by using the Lipofectamine RNAiMax system (Thermo Fisher Scientific). Hypoxia was performed as previously described (24) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human embryonic stem cell line H9 was cultured on the 6-well plate coated with the Vitronectin (5 μg/ml) and in the Essential 8 Flex medium (both Thermo Fisher). Cells were split every 7 days using 5-minute incubation with 0.5 mM EDTA-PBS (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: A volume of 6 µl phosphopeptides or 500 ng of peptides were directly loaded onto reversed-phase pre-column (Acclaim PepMap 100, Thermo Scientific) and eluted in backflush mode ...
-
bioRxiv - Neuroscience 2024Quote: Determination of sIL-6R was performed in the FN of NL and 21 dpi of aged WT and GFAP-IL6Tg (n=3-6/experimental group) using a precoated mouse ELISA kit (EMIL6RA, Fisher Scientific) and following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Human TS cells were plated at 80,000 cells per well in 6-well tissue culture-treated plates coated with 5 μg/mL collagen IV (CB40233; Thermo Fisher) and incubated for 24 h ...
-
bioRxiv - Neuroscience 2023Quote: ... NPCs to be terminally differentiated were passaged on three days after IL-6 stimulation (D21) into 50ng/ml poly-l-ornithine (Gibco; A3890401) and 20ng/ml laminin (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... 20-μl samples were assessed for thermal shifts in 96-well plates on a Quant Studio 6 Flex System (Applied Biosystems) using the melting curve setting and measuring fluorescence using the ROX reporter setting ...
-
bioRxiv - Immunology 2024Quote: ... and vapA specific TaqMan™ primer and probe (Forward: GAGCAGCAGTACGACGTTCA; Reverse: GGCCCGAATACGTGAAACCT; Reporter: CAGCGCGGTCGTCTAC) in the instrument QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2024Quote: ... membranes were transferred into clean 6-well plates with ice cold phosphate-buffered saline with magnesium and calcium (PBS-MC Gibco; 14040141). Somata were then dislodged from the upper surface of the membrane through gentle trituration with ice-cold PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... both retinas from either three (6-week-old) or two (12- or 18-week-old) fish were pooled and collected in Leibovitz 15 (L15, ThermoFisher Scientific) medium complemented with 2% Penicilin-Streptomycin (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2024Quote: ... Barcoded beads were resuspended in lysis buffer (200 mM Tris-HCl pH8.0, 20 mM EDTA, 6% Ficoll PM-400 (GE Healthcare/Fisher Scientific), 0.2% Sarkosyl (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... The lentiviral construct of interest was co-transfected with the packaging constructs pCMV-VSV-G and pCMV Gag/Pol at a ratio of 10 µg: 4 µg: 6 µg respectively using Lipofectamine 2000 (60 µL, Invitrogen 11668027). After 4 h ...
-
bioRxiv - Cell Biology 2024Quote: ... and these values were re-calibrated based on measurements of NIST-certified polystyrene beads (2 µm and 6 µm in diameter, Duke Standards, Thermo Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and purity (260/280 absorbance ratio of approximately 1.6–2.0 and 260/230 absorbance ratio of approximately 1.8–2.4) confirmed with a NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, USA). Sufficient strand lengths (80% > 40 Kbp length ...
-
bioRxiv - Immunology 2024Quote: ... Raji (from DSMZ) and NALM-6 cells (kindly provided by Adolfo Cavalié, Saarland University) were cultured in RPMI 1640 (ThermoFisher Scientific) supplemented with 10% fetal calf serum (ThermoFisher Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... BA disks were prepared by transferring 10 μL of preheated 500 mg/mL BA in dimethyl sulfoxide (DMSO) stock to blank antimicrobial disks (6 mm, Fisher Scientific). MH plates were incubated at 37 °C for 48 h ...
-
bioRxiv - Genomics 2024Quote: ... to a final volume of 200 μL and then incubated 90 min at 37°C with 6 μL of RNase cocktail (Ambion, AM2286), followed by 150 minutes at 55°C with Proteinase K (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... 10 min at 95 °C followed by 40 cycles of 10 sec at 95 °C and 40 sec at 60 °C using the Quant 6 real-time PCR instrument (Applied Biosystems). Samples were considered positive for Giardia spp ...
-
bioRxiv - Immunology 2024Quote: ... non-sun-exposed skin as previously described(13) and used at passages 2-6 and grown in Epilife medium (Gibco, #MEPI500CA) with added human keratinocyte growth supplement (10ul/ml medium) ...
-
bioRxiv - Microbiology 2024Quote: ... initial DNA libraries (including 6-12 degenerate NNK codons) were transcribed to mRNA using T7 RNA polymerase (37 °C, 16 hr) (Thermo Scientific) and ligated to a puromycin linker primer ([5’Phos]CTCCCGCCCCCCGTCC[SP18][SP18][SP18][SP18][SP18]CC[Puromycin] ...