Labshake search
Citations for Thermo Fisher :
3951 - 4000 of 10000+ citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... CU-ACC cells were cultured in 3:1 (v/v) Ham’s F-12 Nutrient Mixture (Gibco #)–DMEM (Gibco # ...
-
bioRxiv - Developmental Biology 2022Quote: ... or miR-483-3p 2⍰-O-Methyl antagonist (anti-human; 0, 50 and 100⍰nM in HepG2) using the Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific – 13778100). Cells were harvested and the luciferase assay was performed as previously described21 using the Dual-Luciferase Reporter Assay System (Promega – E1910) ...
-
bioRxiv - Bioengineering 2022Quote: ... The rat tail collagen I protein and GFOGER peptide peptide were subsequently blocked using methyl-PEG24-amine (MA-PEG24) (Thermo Fisher Scientific). Post functionalization ...
-
bioRxiv - Neuroscience 2024Quote: We derivatized the dried polar and protein samples using methoxyamine HCl (20 mg/mL) in pyridine and N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; Thermo Fisher Scientific). For the polar fraction ...
-
bioRxiv - Microbiology 2020Quote: ... The wells were washed 3 times with 1 mL PBS 1X and covered with a mixture containing secondary goat anti-rabbit-Alexa488 antibodies (Invitrogen Molecular Probe 2mg.mL-1, 1/300e) and DAPI (1/100e ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a binary solvent system of 2% acetonitrile with 0.1% formic acid (Solvent A) and 80% acetonitrile with 0.1% formic acid (Solvent B) in an Easy nLC-1000 system (Thermo Fisher Scientific). 2 μL of peptide solution was loaded using Solvent A onto an Acclaim PepMap100 C18 trap column (2 cm x 75 μm inner diameter) ...
-
bioRxiv - Systems Biology 2020Quote: ... water with 0.1% formic acid (v/v) and acetonitrile with 0.1% formic acid (v/v) were purchased from Fisher Scientific (Leicester, U.K.). Methanol and isopropanol were purchased from Honeywell (Charlotte ...
-
bioRxiv - Neuroscience 2022Quote: ... Mobile phases A and B were with 0.1% formic acid in water and 0.1% formic acid (Fisher Scientific; Cat#: A11710X1-AMP) in ACN (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... of acetonitrile (with 0.1 % formic acid) in solvent (0.1% formic acid in water) for 80 min and sprayed directly into the Orbitrap instrument (Thermo Fisher Scientific). MS1 scans were collected at 120,000 resolutions in a 320–2,000 m/z range with 100 ms max injection time (IT ...
-
bioRxiv - Biochemistry 2022Quote: ... formic acid (FA), difluoroacetic acid (DFA), trifluoracetic acid (TFA), Zeba™ Spin Desalting Columns (7K MWCO, 0.5 mL) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Plant Biology 2024Quote: ... jasmonic acid (JA) and abscisic acid (ABA) by ultra-high performance liquid chromatography-mass spectrometry (UHPLC-MS, Q-Exactive, ThermoFisher Scientific)26.
-
bioRxiv - Immunology 2024Quote: ... All LC/MS solvents and reagents were the highest purity available (water, acetonitrile, acetic acid, boric acid, sodium hydroxide) and were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: ... Incubation with primary antibodies (PARP1, Thermo Fisher, Cat#MA 3-950, TSG101, Thermo Fisher, Cat#MA 1-23296, both diluted 1:200) was done overnight at 4°C.
-
bioRxiv - Biochemistry 2020Quote: ... The wells were washed with 1% BSA/LBB and incubated for 1 hour with L9393 (1:5,000 dilution) in 3% BSA/LBB followed by incubation with Horseradish Peroxidase (HRP)-conjugated anti-rabbit IgG (Invitrogen, 1:5,000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... On the second day samples were washed (0.3% PBSTx, 3×1 hr) and subsequently incubated with the secondary antibody (Alexa-labelled GAM555 plus, Thermo Scientific, 1:1,000) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Testes were homogenized manually followed by dropping 1 μl of suspension into 30 μl of hypotonic solution (1/3 of 1× PBS) and then dropped onto SuperFrost® slides (Menzel Gläser; Thermo Fisher Scientific). The samples were fixed in 400 μl of 2% PFA for 4 min ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-β-ACTIN (AB0145-200, SICGEN, 1:1000 or 3 ug/mL) and rabbit anti-GFP (A-6455, Invitrogen, 1:1000). The secondary antibodies used were Sheep IgG (H&L ...
-
bioRxiv - Cell Biology 2020Quote: The following antibodies were used: anti-cleaved-caspase 3 (1:200; CST, #9664s) and secondary Alexa Fluor 647 anti-rabbit (1:500; Invitrogen, #A-20991). Reagents including EN6 (Selleck ...
-
bioRxiv - Genomics 2022Quote: ... HEK293FT cells were replated at a 1:3 dilution one day post-transfection into media supplemented with 1 μg/mL final concentration puromycin (Thermo Fisher Scientific). HEPG2 cells (American Type Culture Collection (ATCC – HB8065 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes (min ...
-
bioRxiv - Physiology 2021Quote: ... The wells were washed with 1% BSA/LBB and incubated for one hour with L9393 (1:5,000 dilution) in 3% BSA/LBB followed by incubation with HRP-conjugated anti-rabbit IgG (Invitrogen, 1:5,000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... with 3 µg plasmid DNA and 1 × 106 cells in 100 µl Opti-MEM (1×) Reduced Serum Medium (Gibco® ThermoFisher Scientific). The electroporated cells were cultured in a non-selective complete medium in a 100 mm × 20 mm cell culture dish (Falcon ...
-
bioRxiv - Evolutionary Biology 2021Quote: For sucrose preference assays, experimental substrates were 1% agarose and contained 1% ethanol and increasing concentrations (200mM, 400mM or 600mM) of sucrose (ThermoFisher #S5-3); control substrates were 1% agarose and contained 1% ethanol.
-
bioRxiv - Bioengineering 2021Quote: ... HEK293FT cells were replated at a 1:3 dilution one day post-transfection into media supplemented with 1 µg/mL final concentration puromycin (Thermo Fisher Scientific). HEPG2 cells (American Type Culture Collection (ATCC – HB8065 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were washed in 0.1% Triton X-100 PBS for 3 × 10 min before incubation with either donkey anti-rabbit Alexa fluor 488 (Invitrogen, 1:1000) or donkey anti-mouse Alexa fluor 555 (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... and cell monolayers were overlaid with 3 mL containing a 1:1 mixture of 1.2% oxoid agar and DMEM (Gibco, Carlsbad, CA, USA) with 10% (vol/vol ...
-
bioRxiv - Developmental Biology 2023Quote: ... we slowly injected 0.5-1 μL rAAV (about 1∼3×109 genome copy (GC)) mixed with Chicago Sky Blue dye (0.1%, Fisher Scientific, Cat # AAA1424214) into the oviduct ampulla using a glass micropipette with tip diameter of ∼10-30 μm ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lungs were dissected and placed in ice cold FACS buffer (1% BSA, 3% FBS, 96% Ca2+ and Mg2+ free PBS) with 1 μg/ml Actinomycin D (ThermoFisher BP606-5). After isolation ...
-
bioRxiv - Cell Biology 2023Quote: ... were seeded on the top of the membrane and cultured for 3 days in DMEM/F12 (1/1) supplemented with 5 % fetal bovine serum (Fetal Clone II; Hyclone, Thermo Scientific, France), 0.2 ng/ml EGF (Gibco) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by culturing with the neural induction medium supplemented with 20 ng/ml human FGF-2).61 The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted at 4000xg and pellets were washed with water (3 × 10 mL) and resuspended in 1 mL of water and 1 mL of TraceMetal Grade 70% HNO3 (Thermo Fisher Scientific). Acidified cell pellets were boiled at 90 °C for 1 hr and pelleted at 4000xg ...
-
bioRxiv - Pathology 2022Quote: ... and cell monolayers were overlaid with 3 mL containing a 1:1 mixture of 1.2% oxoid agar and DMEM (Gibco, Carlsbad, CA, USA) with 10% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... (3) positive staining for IBA1 (rabbit primary, Wako, 019-1974, 1:2000, donkey anti-rabbit 647 Life Technologies, A-31573, 1:1000) via 2D immunofluorescence imaging and (4 ...
-
bioRxiv - Bioengineering 2024Quote: ... NK cells and target cells were mixed at an effector to target (E/T) ratio of 4:1 (SK-BR-3 cells) or 2:1 (K562 cells) and Sytox Green (Thermo Fisher Scientific) was added at 100 nM ...
-
bioRxiv - Bioengineering 2024Quote: ... in 1X TBS adjusted to pH 7.6 for 1 hour at room temperature and rinsed 3 times for 1 hour in 0.1% Tween-20 (Thermo Fisher, Waltham, MA) in 1X TBS adjusted to pH 7.6 (TBS-T) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged every 2-3 days with 1:4-1:6 ratio by incubation cells with 0.5 mM EDTA (Fisher Scientific MT-46034CI) for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Cancer Biology 2021Quote: ... The pHrodo-TDM1 was obtained by conjugating the free lysine residues of TDM1 with the amine-reactive pH-sensitive pHrodo iFL Red STP ester dye (ThermoFisher Scientific, P36014) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... recombinant S was labeled with Alexa Fluor 7647-NHS ester or biotinylated using the EZ-Link Micro NHS-PEG4-Biotinylation Kit (Thermo Fisher Scientific); excess Alexa Fluor 647 and biotin were removed using 7-kDa Zeba desalting columns (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: Fluorescently-labelled microtubules were polymerized from 4 mg/ml porcine tubulin (80% unlabelled and 20% Alexa Fluor 647 NHS ester-labelled; Thermo Fisher Scientific) for 2 h at 37 °C in BRB80 (80 mM PIPES ...
-
bioRxiv - Cell Biology 2021Quote: ... before gentle sonication and then addition of 5µg/ml total protein dye (Alexa Fluor™ 647 NHS Ester dye; ThermoFisher Scientific; A20006) and incubation (4°C ...
-
bioRxiv - Physiology 2021Quote: ... adherent islet cells were loaded with 5μM of the acetoxymethyl (AM) ester form of the calcium indicator Fura-2 (Thermo Fisher Scientific #F1221) for 30min ...
-
bioRxiv - Biochemistry 2020Quote: ... Covalent labeling of amine groups of the proteins with Alexa Fluor 488 or Alexa Fluor 647 succinimidyl ester dyes (Molecular probes/Invitrogen) was conducted in its polymer-assembled form as previously described (González et al ...