Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... succinimidyl ester (Thermo Fisher Scientific). 14.4.4 scFV harboring an unpaired cysteine residue were site-specifically conjugated with Alexa Fluor 647 C2 Maleimide ...
-
bioRxiv - Immunology 2023Quote: ... succinimidyl ester (Thermo Fisher Scientific) or Alexa Fluor 647 carboxylic acid ...
-
bioRxiv - Microbiology 2023Quote: Texas Red-succinimidyl ester (Invitrogen) was dissolved to a final concentration of 20 mg/ml in high quality anhydrous N,N-dimethylformamide at 4 °C (81) ...
-
bioRxiv - Biochemistry 2022Quote: ... Alexa-647 NHS ester (Invitrogen) or iFluor-488/Cy3 NHS ester (AAT Bioquest ...
-
bioRxiv - Biophysics 2023Quote: ... Succinimidyl Ester (AcX, ThermoFisher, A20770) for ≥ 6 h at RT ...
-
bioRxiv - Genetics 2023Quote: ... acetyl ester (CM-H2DCFDA; Invitrogen). Medium from larvae was placed in culture media containing 5 μM CM-H2DCFDA for 90 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... succinimidyl ester (ThermoFisher Scientific, P36600), or the pH-insensitive dye ...
-
bioRxiv - Cell Biology 2023Quote: ... ethyl ester (TMRM+, Life Technologies) for 30 min at 37◦C plus mitotracker deep Red (MTDR) ...
-
bioRxiv - Microbiology 2023Quote: ... succinimidyl ester (ThermoFisher, Waltham, MA) from a 1mg/150μL stock solution in DMSO (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... tetrafluorophenyl ester (Thermo Fisher Scientific) as previously described [31] ...
-
bioRxiv - Cell Biology 2024Quote: ... Ethyl Ester (TMRE) (Thermo Fisher), or 5 uM SYTO RNAselect (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: ... Aqueous 0.85% w/v methyl cellulose was prepared by dissolving powdered methyl cellulose (Thermo Scientific Chemicals ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 µl of Novec 7500 containing 20 % 1H,1H,2H,2H-perfluorooctanol (PFO; ThermoFisher Scientific GmBH, Germany) was added to the suspension and mixed by pipetting resulting in bead clustering ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.3) simultaneously with a 5-fold molar excess of Alexa Fluor 647 NHS Ester (ThermoFisher, A20006) and a 5-fold molar excess of EZ-Link NHS LC-LC-Biotin (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Sorted memory CD4+ T cells were labelled with 5-(and 6)-carboxyfluorescein diacetate succinimidyl ester (CFSE, ThermoFisher) and cultured at a ratio of 2:1 with irradiated autologous monocytes untreated or pulsed for 3 h with recombinant SARS-CoV-2 Spike protein (2.5 μg/ml) ...
-
bioRxiv - Immunology 2022Quote: Spleen cells (3.0 × 107) were stained with 5 μM 5,6-carboxyfluorescein succinimidyl ester (CFSE; Molecular Probes, USA) in phosphate-buffered saline with 0.1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... mixed retinal cultures were loaded with 5 µM Fura-2 AM (acetoxymethyl ester, #F1221; Thermo Fisher Scientific) with 0.01% pluronic F-127 (#P3000MP ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... tissues were incubated with a species-specific secondary antibody (Alexa 647) for 1h then washed 3 times with PBS and mounted using ProLong Gold Antifade Mountant with DAPI (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... Following another 3 washes with PBS plates were incubated for 1h with secondary goat anti-guinea pig-AlexaFluor488 (Invitrogen, UK) at 1:500 in PBS-0.5%BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... the slides were washed 3 times with PBS and incubated for 1h at room temperature with goat anti-rabbit AlexaFluor-568 (ThermoFisher, Invitrogen A-1101 ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked for 1h at room temperature in 3% BSA/PBS supplemented with 0.1% Tween 20 (BP337-100, Fisher Scientific), incubated at 4°C overnight with primary antibody in 3% BSA/PBS + 0.1% Tween 20 ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cell Biology 2024Quote: ... Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion, USA #4390824); Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11a - 5’-CAACAAUGUGGUUCCUAUUtt-3’ (Ambion, USA #4390824); Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion, USA #4390824). The transfection of single siRNA or a combination of different siRNAs and the rescue of siRNA-treated cells with co-transfection of plasmid DNA and siRNA were completed according to the manufacturer’s (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Bioengineering 2024Quote: ... we neutralized acid-extracted Collagen I (3 mg/ml, Gibco, A1048301) using 10X DMEM and 2N NaOH ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Biophysics 2022Quote: ... BODIPY FL NHS Ester (Succinimidyl Ester) (NHS-BODIPY; catalog number: D2184) were purchased from Invitrogen.
-
bioRxiv - Biochemistry 2024Quote: ... Alexa Fluor 568 NHS Ester and DyLight 633 NHS Ester were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Microbiology 2023Quote: ... MES and methyl-salicylate (ACROS Organics); sodium ferulate (Selleck Chemical) ...